Sequential DNA Methylation of the Nanog and Oct-4 Upstream Regions in Human NT2 Cells during Neuronal Differentiation
Notice bibliographique
Résumé
Human NT2 cells, which differentiate into neurons and astrocytes, initially express and then permanently down-regulate Nanog and Oct-4 (POU5F1). We investigated the relationship between the expression of these genes and the methylation state of their 5′-flanking regions. Gene expression and DNA methylation were assayed with quantitative polymerase chain reaction and bisulfite genomic sequencing, respectively. Retinoic acid-induced differentiation of NT2 cells to neurons is accompanied by a sequential decrease in the expression of both genes, paralleled by sequential epigenetic modification of their upstream regions. This is the first report demonstrating changes in DNA methylation in the promoter regions of Nanog and Oct-4 in a human cell line. Human NT2 cells, which differentiate into neurons and astrocytes, initially express and then permanently down-regulate Nanog and Oct-4 (POU5F1). We investigated the relationship between the expression of these genes and the methylation state of their 5′-flanking regions. Gene expression and DNA methylation were assayed with quantitative polymerase chain reaction and bisulfite genomic sequencing, respectively. Retinoic acid-induced differentiation of NT2 cells to neurons is accompanied by a sequential decrease in the expression of both genes, paralleled by sequential epigenetic modification of their upstream regions. This is the first report demonstrating changes in DNA methylation in the promoter regions of Nanog and Oct-4 in a human cell line. The Nanog and Oct-4 (POU5F1) transcription factors are key intrinsic determinants of self-renewal of embryonic stem cells (1Chambers I. Smith A. Oncogene. 2004; 23: 7150-7160Crossref PubMed Scopus (442) Google Scholar). Oct-4 is a member of the POU family of transcription factors and is expressed in both embryonic stem (ES) 1The abbreviations used are: ES, embryonic stem; RA, retinoic acid; EC, embryonal carcinoma; TSS, transcription start site; CR; conserved region. 1The abbreviations used are: ES, embryonic stem; RA, retinoic acid; EC, embryonal carcinoma; TSS, transcription start site; CR; conserved region. cells and embryonal carcinoma (EC) cells. Nanog, the most recently described homeodomain gene (2Chambers I. Colby D. Robertson M. Nichols J. Lee S. Tweedie S. Smith A. Cell. 2003; 113: 643-655Abstract Full Text Full Text PDF PubMed Scopus (2595) Google Scholar, 3Mitsui K. Tokuzawa Y. Itoh H. Segawa K. Murakami M. Takahashi K. Maruyama M. Maeda M. Yamanaka S. Cell. 2003; 113: 631-642Abstract Full Text Full Text PDF PubMed Scopus (2522) Google Scholar), is expressed in a restricted number of cell types and only in a subset of cells that express Oct-4, including embryonic stem cells (1Chambers I. Smith A. Oncogene. 2004; 23: 7150-7160Crossref PubMed Scopus (442) Google Scholar). It has been shown that Nanog function requires the continued presence of Oct-4 and together they support stem cell potency and self-renewal (4Cavaleri F. Scholer H.R. Cell. 2003; 113: 551-552Abstract Full Text Full Text PDF PubMed Scopus (123) Google Scholar). Oct-4 prevents the differentiation of the inner cell mass and embryonic stem cells into trophectoderm, while Nanog blocks the differentiation into primitive endoderm and actively maintains pluripotency (5Pan G.J. Pei D.Q. Cell Res. 2003; 13: 499-502Crossref PubMed Scopus (47) Google Scholar). Nanog and Oct-4 are both expressed in pluripotent mouse and human cell lines including the undifferentiated human embryonal carcinoma cell line, NT2/D1 (6Hart A.H. Hartley L. Ibrahim M. Robb L. Dev. Dyn. 2004; 230: 187-198Crossref PubMed Scopus (272) Google Scholar). The undifferentiated cells become committed to differentiate with retinoic acid (RA), unleashing a genetic program that involves the differential expression of more than 3000 genes (7Walker P.R. Ly D. Liu Q.-Y. Smith B. Sodja C. Ribecco M. Sikorska M. Janigro D. The Cell Cycle in the CNS. Humana Press, Totowa, NJ2005Google Scholar). Oct-4 protein levels are down-regulated in NT2 cells induced with RA to differentiate into neurons and glia (8Rosfjord E. Rizzino A. Biochem. Biophys. Res. Commun. 1994; 203: 1795-1802Crossref PubMed Scopus (35) Google Scholar). In an ongoing effort to gain an overall understanding of the contribution of genetic and epigenetic factors to the control of neurogenesis, this study evaluates the changes in expression of Nanog and Oct-4 in the early stages of neuronal differentiation in relation to DNA methylation of their upstream regions. Methylation of genomic CpG residues is known to play a key role in embryogenesis by silencing specific genes during development and differentiation. DNA methylation in the region 1.3 kb upstream of the mouse Oct-4 gene has previously been reported by following RA treatment of mouse OTF9–63 EC cells (9Ben-Shushan E. Pikarsky E. Klar A. Bergman Y. Mol. Cell. Biol. 1993; 13: 891-901Crossref PubMed Scopus (68) Google Scholar). These experiments, performed using methylation-sensitive restriction endonucleases, lacked base pair resolution but did establish that methylation operates in mouse cells. Subsequently, the mouse Oct-4 promoter was shown to undergo methylation at 6.5 days postcoitum in the whole embryo (10Gidekel S. Bergman Y. J. Biol. Chem. 2002; 277: 34521-34530Abstract Full Text Full Text PDF PubMed Scopus (115) Google Scholar). Moreover, Hattori et al. (11Hattori N. Nishino K. Ko Y.G. Hattori N. Ohgane J. Tanaka S. Shiota K. J. Biol. Chem. 2004; 279: 17063-17069Abstract Full Text Full Text PDF PubMed Scopus (342) Google Scholar) demonstrated methylation of the mouse Oct-4 promoter region in trophoblast stem cells. In an attempt to study the possibility of reversing the differentiation process, Tsuji-Takayama et al. (12Tsuji-Takayama K. Inoue T. Ijiri Y. Otani T. Motoda R. Nakamura S. Orita K. Biochem. Biophys. Res. Commun. 2004; 323: 86-90Crossref PubMed Scopus (68) Google Scholar) treated differentiated ES cells with a demethylating agent and found an increase in the expression of ES-specific genes such as Oct-4, Nanog, and Sox2. However, in this case, expression of any of these three genes could be an indirect consequence of demethylation of another gene. To our knowledge, the work presented here is the first report of direct changes in DNA methylation of specific sites within the promoter regions of human Oct-4 and Nanog genes during neurogenesis. We show that Nanog and Oct-4 are sequentially down-regulated early in RA-treated NT2 cells and that the decreases in gene expression are paralleled by dynamic, sequential methylation of CpG residues in both promoter regions as well as the enhancer region of Oct-4. Cell Culture and DNA Isolation—NT2/D1 cells (Stratagene, La Jolla, CA) were seeded at a density of 2 × 106 cells per T75 flask and treated with 10 μm RA (Sigma, Oakville, Ontario, Canada) for 2–12 days. Fresh RA and Dulbecco's modified Eagle's medium (Invitrogen, Burlington, Ontario, Canada) supplemented with 10% fetal bovine serum (Wisent, Saint-Jean, Quebec, Canada) were supplied every 2 days. Cells were harvested at different time points by trypsinization, centrifuged at 194 g for 5 min, and washed with phosphate-buffered saline. Total genomic DNA was isolated from each sample (adapted from Ref. 13Miller S.A. Dykes D.D. Polesky H.F. Nucleic Acids Res. 1988; 16: 1215Crossref PubMed Scopus (17628) Google Scholar). Quantitative PCR—RNA was isolated with TriReagent (Bio-Can Scientific, Mississauga, Ontario, Canada), and a 20 μg/sample was used for cDNA synthesis using Superscript II reverse transcriptase (Invitrogen). Each duplicate quantitative PCR reaction contained 2 ng of cDNA and a 0.15 μm concentration of each primer in a 25-μl reaction volume. The 2 × PCR SYBR Green master mix was purchased from Applied Biosystems (Foster City, CA). PCR reactions were carried out in an Applied Biosystems 7000 machine as follows: 50 °C for 2 min for 1 cycle, 95 °C for 10 min for 1 cycle, and 40 cycles of 95 °C for 15 s and 60 °C for 1 min. A dissociation curve was run at the end of the reaction for product specificity. Bisulfite Genomic Sequencing—The EZ DNA methylation kit (Zymo Research, Orange, CA) was used to detect cytosine methylation. The sodium bisulfite treatment used 750 ng of genomic DNA. Briefly, the DNA was denatured with a dilution buffer containing 2 m NaOH and incubated overnight at 50 °C with CT conversion reagent, followed by a clean-up, desulfonation, and elution. The bisulfite-modified DNA was used immediately for PCR or stored at –70 °C. For PCR amplification, 2.5 μl of bisulfite-modified DNA was added in a final volume of 50 μl, containing 1 × PCR buffer (16.6 mm ammonium sulfate, 67 mm Tris, pH 8.8, 6.7 mm MgCl2, 10 mm 2-mercaptoethanol), dNTPs (1.25 mm concentration each), primers (1 pmol each), and 2.5 units of Hi Fidelity Platinum Taq (Invitrogen). The primers were designed to recognize the bisulfite-converted DNA only (Table I). PCR reactions were carried out in a MJ Research cycler (Waltham, MA) using the following protocol: 95 °C for 10 min, 35 cycles of 95 °C for 1 min, 50–58 °C for 1 min, and 72 °C for 1 min, followed by an extension at 72 °C for 10 min and soak at 4 °C. After electrophoresis on a 2% agarose gel the remaining PCR products were cloned (Zero Blunt End, Invitrogen). Ten clones for each ligation were randomly picked and sequenced on an Applied Biosystems 377 instrument.Table IA list of primers, their sequences, and the annealing temperatures used for PCRPrimer (GenBank™ accession no.)SequenceAnnealing temperatureQPCRNanog-F (NM_024865)GCAGAAGGCCTCAGCACCTA60Nanog-RAGGTTCCCAGTCGGGTTCAOct4-F (Z11898)GCTCGAGAAGGATGTGGTCC60Oct4-RCGTTGTGCATAGTCGCTGCTN-Oct3-F (Z11933)GAGCGAGGAGAGGGAGCC60N-Oct3-RTCTCGGAGCCGGACTGAGPax6-F (NM_000280)CACACCGGTTTCCTCCTTCA60Pax6-RGGCAGAGCGCTGTAGGTGTTSox2-F (Z11898)CACTGCCCCTCTCACACATG60Sox2-RTCCCATTTCCCTCGTTTTTCTBisulfite PCRNanog-FTTAATTTATTGGGATTATAGGGGTG58Nanog-RAAACCTAAAAACAAACCCAACAACOct4-1FTTTTTAGTTTTTTTTAGGTTTAA50Oct4-1RTAAACAAAAAACCCATTCCCOct4-2FTTAGGAAAATGGGTAGTAGGGATTT58Oct4-2RTACCCAAAAAACAAATAAATTATAAAACCTOct4-3FATTTGTTTTTTGGGTAGTTAAAGGT58Oct4-3RCCAACTATCTTCATCTTAATAACATCCOct4-4FGGATGTTATTAAGATGAAGATAGTTGG58Oct4-4RCCTAAACTCCCCTTCAAAATCTATTOct4-5FAATAGATTTTGAAGGGGAGTTTAGG58Oct4-5RTTCCTCCTTCCTCTAAAAAACTCAOct4-6FGAAGGGGAAGTAGGGATTAATTTT58Oct4-6RCAACAACCATAAACACAATAACCAAOct4-7FTAGTTGGGATGTGTAGAGTTTGAGA58Oct4-7RTAAACCAAAACAATCCTTCTACTCCOct4-8FAAGTTTTTGTGGGGGATTTGTAT58Oct4-8RCCACCCACTAACCTTAACCTCTAOct4-9FGTTAGAGGTTAAGGTTAGTGGGTG58Oct4-9RAAACCTTAAAAACTTAACCAAATCC Open table in a new tab Down-regulation of the Human Nanog and Oct-4 Genes following RA Treatment—Quantitative PCR analysis of RNA extracted following RA treatment of NT2/D1 cells shows a decline in the expression levels of Oct-4 and Nanog (Fig. 1). Nanog expression starts to decline immediately, whereas there is a two-day delay before Oct-4 expression declines. The expression of Sox2, a binding partner for Oct-4, does not change. Pax6, a marker for radial glia and N-Oct3 (POU3F2), which is essential for neuronal migration and corticogenesis; each shows an increase in gene expression coinciding with the down-regulation of Nanog and Oct-4. Both Oct-4 and Nanog show a significant drop in gene expression by day 4 and are reduced to very low levels by days 6 and 8 of RA treatment. DNA Methylation Status of the 5′-Flanking Region of the Human Nanog Gene—Human Nanog is a newly identified gene on chromosome 12p13.31, whose promoter has not been characterized. The gene has 4 exons and 3 introns, comparable with the mouse chromosome 6 homolog (14Clark A.T. Rodriguez R.T. Bodnar M.S. Abeyta M.J. Cedars M.I. Turek P.J. Firpo M.T. Reijo Pera R.A. Stem Cells. 2004; 22: 169-179Crossref PubMed Scopus (202) Google Scholar, 15Booth H.A. Holland P.W. Genomics. 2004; 84: 229-238Crossref PubMed Scopus (112) Google Scholar). We examined a section of DNA 500 bases upstream of the transcription start site (TSS). This probable promoter region shares homology with the mouse upstream region (1Chambers I. Smith A. Oncogene. 2004; 23: 7150-7160Crossref PubMed Scopus (442) Google Scholar), including conserved Oct-4 and Sox2 DNA-binding domains located at –104 to –118 bp. CpGs are sparsely spaced in this stretch of DNA. However, we observed a change in the methylation status for three closely spaced sites starting at day 4 of RA treatment (Fig. 2). This cluster is ∼200 bp upstream of the Oct-4/Sox2-binding domain. These sites are unmethylated (presence of an A residue, indicating a T residue on the opposite strand) in the undifferentiated state (Fig. 3) and remain methylated at day 10 RA (presence of a G residue indicating a methylated cytosine on the opposite strand, which does not convert to a T following bisulfite treatment). The percentage of clones with methylation at the three sites shows a steady increase from day 4 RA onwards, and the cluster remains methylated (>50%) beyond day 8 of RA treatment (Fig. 2) corresponding to the silencing of the gene.Fig. 3Bisulfite sequencing of the 5′-upstream region of the Nanog gene. The three CpG sites (along with their locations) that get methylated at day 10 RA are shown with the arrows. Unmethylated CpGs are represented by an A, indicating a T residue on the opposite strand. The presence of a G residue indicates a methylated cytosine on the opposite strand.View Large Image Figure ViewerDownload Hi-res image Download (PPT) DNA Methylation Profile of the 5′-Flanking Region of the Human Oct-4 Gene—The human Oct-4 gene, located on chromosome 6p21.31 is alternatively spliced, encoding two isoforms, 1 and 2. For this study, we looked at the region upstream of isoform 1 (GenBank™ accession number AJ297527), which has 5 exons and 4 introns. The gene encodes an mRNA sequence of 1413 bp and a protein of 360 amino acids (GenBank™ accession number NM_002701). There is no CpG island at the 5′ end of the Oct-4 gene (16Li L.C. Dahiya R. Bioinformatics. 2002; 18: 1427-1431Crossref PubMed Scopus (1913) Google Scholar), although CpG dinucleotide sequences are fairly abundant. We investigated the methylation status of 45 CpGs (Fig. 4) between –2973 and +153 bp from the TSS (+1). This region spans the proximal promoter and the proximal and distal enhancers (17Nordhoff V. Hubner K. Bauer A. Orlova I. Malapetsa A. Scholer H.R. Mamm. Genome. 2001; 12: 309-317Crossref PubMed Scopus (144) Google Scholar). Most of these sites are unmethylated in the undifferentiated cells, and there is a gradual increase in methylation by day 8 RA, which becomes much more extensive by day 12 of RA treatment (Fig. 4). In addition, the promoter/enhancer region has seven constitutively methylated CpGs between –464 and –825 (between the proximal promoter and the proximal enhancer) and two sites at –2724 and –2733 (upstream of the distal enhancer). The block of seven sites, already methylated in the undifferentiated cells remains methylated throughout, although there is an increase in the percentage of methylated clones even for these sites, increasing from 61% at day 0 to 90% by day 12 RA. Interestingly, the CpGs at different sites become methylated with different kinetics during the differentiation process (Fig. 4). Once methylated, the sites do not undergo demethylation at a later stage and the gene remains repressed. The specification of cell lineages in the developing brain is thought to be regulated by extrinsic and intrinsic factors. The intrinsic program of neuronal differentiation in NT2 cells, for example, involves the sequential expression of specific transcription factors, receptors, and signaling molecules (7Walker P.R. Ly D. Liu Q.-Y. Smith B. Sodja C. Ribecco M. Sikorska M. Janigro D. The Cell Cycle in the CNS. Humana Press, Totowa, NJ2005Google Scholar). The cells pass through a series of transient states; epigenetic modifications such as chromatin remodeling and DNA methylation play a key role in defining these states. CpG dinucleotides are the major target for DNA methylation, with cytosines on both strands being prone to modification to 5-methylcytosine. This has been shown to be a major mechanism of transcriptional silencing (18Siegfried Z. Eden S. Mendelsohn M. Feng X. Tsuberi B.Z. Cedar H. Nat. Genet. 1999; 22: 203-206Crossref PubMed Scopus (279) Google Scholar). Most vertebrate DNA is de novo methylated at cytosine residues of CpG dinucleotides and must be demethylated to permit transcription. Stretches of GC-rich and relatively CpG-rich DNA sequences co-localize with some, but not all, promoter regions of genes. Methylation of only a few of these CpG sites can significantly down-regulate promoter activity (19Gonzalgo M.L. Hayashida T. Bender C.M. Pao M.M. Tsai Y.C. Gonzales F.A. Nguyen H.D. Nguyen T.T. Jones P.A. Cancer Res. 1998; 58: 1245-1252PubMed Google Scholar). Methyl-CpG is now recognized as a gene-silencing signal (20Zhang Z. Chen C.Q. Manev H. J. Neurochem. 2004; 88: 1424-1430Crossref PubMed Scopus (27) Google Scholar) because methylated CpG either interferes with the DNA binding of transcription factors or recruits methylated which then such as Nanog and Oct-4 are expressed in undifferentiated NT2 cells, we to a relationship between DNA methylation and gene expression in an in of human neurogenesis. This of NT2 that can be differentiated into neurons and with RA. To the methylation status of the two genes, we used the bisulfite sequencing J. M. Nucleic Acids Res. 1994; 22: PubMed Scopus Google Scholar), which a of every methylated CpG site in a target We show that CpG dinucleotides in the promoter region of both genes, as well as the enhancer region of Oct-4, are unmethylated in the undifferentiated state the genes are differentiation the CpG dinucleotides become DNA methylation of the two genes is their sequential decrease in an being the block of constitutively methylated CpG sites immediately upstream of the Oct-4 proximal This is a the function of this block is We that could be a to chromatin modification DNA methylation to the proximal promoter and enhancer as the cells the stem or embryonal cell state following RA treatment. the human Oct-4 promoter has not been we our of the on the of the and bovine Oct-4 upstream regions by et al. (17Nordhoff V. Hubner K. Bauer A. Orlova I. Malapetsa A. Scholer H.R. Mamm. Genome. 2001; 12: 309-317Crossref PubMed Scopus (144) Google Scholar). identified conserved sequences in the human Oct-4 upstream to to to and to to the spans the proximal promoter and in the three The region in the human and bovine In the mouse and the proximal and distal respectively. To no DNA binding activity has been with our is that three of the CpG sites in the human proximal promoter are not methylated in the undifferentiated stage and are de novo methylated at later stages of differentiation. of the Oct-4 gene in EC cells requires by transcription factors or DNA-binding of sites in the proximal promoter as well as the proximal and distal down-regulation by retinoic acid is paralleled by the of factors from three sites S. V. A. I. K. K. Scholer H.R. J. PubMed Scopus Google Scholar, A. K. PubMed Scopus Google Scholar) followed by the transient binding of J. L. S. A. A. Mol. Biol. PubMed Scopus Google Scholar, I. Scholer H.R. Cell. Mol. Biol. 1999; Google Scholar). DNA methylation is to play a direct role in the of transcriptional activity but silencing of the gene. remain to be carried out for In both genes, there is a significant delay between levels of and methylation, that methylation per is not the in gene transcription but is in a later of In of the few on the kinetics of DNA methylation, and V. J. 2004; 23: PubMed Scopus Google Scholar) recently the transcriptional silencing of and DNA methylation as the the of and and as early in a sequence of to the process of the gene is transcription can be by of Methylation of and of DNA cytosines in the are later that could this chromatin these for genes as well has not been However, has been in the of mouse Oct-4 (10Gidekel S. Bergman Y. J. Biol. Chem. 2002; 277: 34521-34530Abstract Full Text Full Text PDF PubMed Scopus (115) Google Scholar) and our support such a In both the presence of promoter region CpG methylation an to to an To modification a key role for gene silencing in this case, we to do a study modifications at the Oct-4 and Nanog upstream regions be by chromatin is that from an embryonal or stem cell state is at in by methylation of the promoter regions of two key determinants of Nanog and Oct-4. this the cells are committed to differentiate or by and in the of NT2 cells, they immediately express the gene, a of the radial glia the of a regulated of DNA methylation is essential for development and the of this epigenetic modification is by the that in DNA methylation are with and cell In addition, DNA methylation has been in a number of including transcriptional of chromatin genomic However, the list of regulated genes that been examined in the of methylation is very This study the of the role of methylation in the control of more genes Nanog and Oct-4 that are in the of ES cells. We for the cell and RNA and J. C. for DNA We are very to for with the
Récupéré en direct depuis OpenAlex et désinversé. Les résumés ne sont pas conservés dans cette base de données : les index inversés représentent 8,6 Go des 9,3 Go de texte de la base, et le serveur dispose de 13 Go libres.
Comment cette classification a été obtenuedéplier
Prédiction distillée sur la base complète
Imitation des enseignantsNi prévalence calibrée, ni vérité terrain. Validation humaine à venir. Apprise à partir de 10 348 étiquettes directes de Codex et de 10 348 étiquettes directes de Gemma. Le mode candidate est l'union des têtes enseignantes seuillées; le consensus est leur intersection. Ces sorties portent le statut machine_predicted_unvalidated et ne sont ni des étiquettes humaines ni des étiquettes directes de modèles de pointe.
Scores Codex et Gemma par catégorie
| Catégorie | Codex | Gemma |
|---|---|---|
| Métarecherche | 0,000 | 0,000 |
| Méta-épidémiologie (sens strict) | 0,000 | 0,000 |
| Méta-épidémiologie (sens large) | 0,000 | 0,000 |
| Bibliométrie | 0,000 | 0,000 |
| Études des sciences et des technologies | 0,000 | 0,000 |
| Communication savante | 0,000 | 0,000 |
| Science ouverte | 0,000 | 0,000 |
| Intégrité de la recherche | 0,000 | 0,000 |
| Charge utile insuffisante (le modèle a refusé de juger) | 0,000 | 0,000 |
Scores machine (provisoires)
Les deux têtes enseignantes du modèle étudiant, lues sur ce travail. Un score ordonne la base pour la relecture; il n'affirme jamais une catégorie, et le statut de validation accompagne chaque rangée tel quel.
Scores de référence d'un modèle non mature (critères de maturité non atteints, 7 itérations). Un score ordonne; il n'affirme jamais une catégorie.
score_only:v0-immature-baseline · tel quel depuis la passe de notation : score_only signifie que le nombre peut ordonner les travaux, et qu'aucune étiquette de catégorie n'en découleClassification
machine, non validéePrédiction automatique; un appel candidat d’une seule tête enseignante, pas un consensus.
Le détail, modèle par modèle et score par score, se trouve en fin de page sous « Comment cette classification a été obtenue ».