A Possible Role of Ku in Mediating Sequential Repair of Closely Opposed Lesions
Notice bibliographique
Résumé
One of the hallmarks of ionizing radiation exposure is the formation of clustered damage that includes closely opposed lesions. We show that the Ku70/80 complex (Ku) has a role in the repair of closely opposed lesions in DNA. DNA containing a dihydrouracil (DHU) close to an opposing single strand break was used as a model substrate. It was found that Ku has no effect on the enzymatic activity of human endonuclease III when the substrate DNA contains only DHU. However, with DNA containing a DHU that is closely opposed to a single strand break, Ku inhibited the nicking activity of human endonuclease III as well as the amount of free double strand breaks induced by the enzyme. The inhibition on the formation of a free double strand break by Ku was found to be much greater than the inhibition of human endonuclease III-nicking activity by Ku. Furthermore, there was a concomitant increase in the formation of Ku-DNA complexes when endonuclease III was present. Similar results were also observed with Escherichia coli endonuclease III. These results suggest that Ku reduces the formation of endonuclease III-induced free double strand breaks by sequestering the double strand breaks formed as a Ku-DNA complex. In doing so, Ku helps to avoid the formation of the intermediary free double strand breaks, possibly helping to reduce the mutagenic event that might result from the misjoining of frank double strand breaks. One of the hallmarks of ionizing radiation exposure is the formation of clustered damage that includes closely opposed lesions. We show that the Ku70/80 complex (Ku) has a role in the repair of closely opposed lesions in DNA. DNA containing a dihydrouracil (DHU) close to an opposing single strand break was used as a model substrate. It was found that Ku has no effect on the enzymatic activity of human endonuclease III when the substrate DNA contains only DHU. However, with DNA containing a DHU that is closely opposed to a single strand break, Ku inhibited the nicking activity of human endonuclease III as well as the amount of free double strand breaks induced by the enzyme. The inhibition on the formation of a free double strand break by Ku was found to be much greater than the inhibition of human endonuclease III-nicking activity by Ku. Furthermore, there was a concomitant increase in the formation of Ku-DNA complexes when endonuclease III was present. Similar results were also observed with Escherichia coli endonuclease III. These results suggest that Ku reduces the formation of endonuclease III-induced free double strand breaks by sequestering the double strand breaks formed as a Ku-DNA complex. In doing so, Ku helps to avoid the formation of the intermediary free double strand breaks, possibly helping to reduce the mutagenic event that might result from the misjoining of frank double strand breaks. Ionizing radiation generates a wide spectrum of DNA damages including single-stranded breaks, base lesions, abasic sites, double-stranded breaks, multiple damage sites, and DNA-protein and DNA-DNA cross-links (1Huttermann J. Kuhnlein W. Teoule R. Effects of Ionizing Radiation on DNA: Physical, Chemical, and Biological aspects . Springer-Verlag New York Inc., New York1978Crossref Google Scholar, 2Von Sonntag C. The Chemical Basis of Radiation Biology. Taylor & Francis Ltd., London1987Google Scholar). The energy from low linear energy transfer-ionizing radiation is not dispersed uniformly in the absorbing medium but is dispersed along the tracks of the charge particles (3Hall E.J. Radiobiology for the Radiobiologist. Lippincott Williams & Wilkins, Philadelphia1994: 17-27Google Scholar). These nonrandom ionized tracks, consisting of “spurs” and “blobs” when traversing a DNA molecule, will generate lesions that are clustered within a small region (3Hall E.J. Radiobiology for the Radiobiologist. Lippincott Williams & Wilkins, Philadelphia1994: 17-27Google Scholar). These clustered lesions commonly referred to as multiple damage sites are the hallmarks of exposure to ionizing radiation (4Ward J.F. Radiat. Res. 1981; 86: 185-195Crossref PubMed Scopus (221) Google Scholar, 5Ward J.F. Prog. Nucleic Acid Res. Mol. Biol. 1988; 35: 95-125Crossref PubMed Scopus (1202) Google Scholar, 6Sutherland B.M. Bennett P.V. Sidorkina O. Laval J. Biochemistry. 2000; 39: 8026-8031Crossref PubMed Scopus (192) Google Scholar, 7Sutherland B.M. Bennett P.V. Sidorkina O. Laval J. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 103-108Crossref PubMed Scopus (407) Google Scholar). The composition of lesions within these clusters is not clear; however, they are expected to consist predominantly of a random mixture of abasic sites, base lesions, and strand breaks (6Sutherland B.M. Bennett P.V. Sidorkina O. Laval J. Biochemistry. 2000; 39: 8026-8031Crossref PubMed Scopus (192) Google Scholar, 7Sutherland B.M. Bennett P.V. Sidorkina O. Laval J. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 103-108Crossref PubMed Scopus (407) Google Scholar). Recently, it was demonstrated that base lesions that are in close proximity to each other are repaired at a reduced rate as compared with isolated base lesions. Bacterial base excision repair enzymes, such as endonuclease III and formamidopyrimidine-N-glycosylase, were shown to be inhibited by nicks formed either directly opposite or closely opposed to a base lesion (8Chaudhry M.A. Weinfeld M. J. Mol. Biol. 1995; 249: 914-922Crossref PubMed Scopus (105) Google Scholar, 9Harrison L. Hatahet Z. Purmal A.A. Wallace S.S. Nucleic Acids Res. 1998; 26: 932-941Crossref PubMed Scopus (111) Google Scholar, 10David-Cordonnier M.-H. Laval J. O'Neill P. J. Biol. Chem. 2000; 275: 11865-11873Abstract Full Text Full Text PDF PubMed Scopus (156) Google Scholar, 11Takeshita M. Chang C.N. Johnson F. Will S. Grollman A.P. J. Biol. Chem. 1987; 262: 10171-10179Abstract Full Text PDF PubMed Google Scholar, 12Bourdat A.-G. Gasparutto D. Cadet J. Nucleic Acids Res. 1999; 27: 1016-1024Crossref Scopus (70) Google Scholar). The biological relevance of this inhibition is not clear; however, it was thought that this would help to reduce the formation of double strand breaks. In mammalian cells, double strand breaks are repaired primarily through the nonhomologous end-joining reaction involving the DNA end-binding protein Ku 1The abbreviations used are: KuKu70/80 complexDHUdihydrouracil and the catalytic subunit of a DNA-dependent protein kinase, p450 (13Freidberg E.C. Walker G.C. Siede W. DNA Repair and Mutagenesis . American Society of Microbiology Press, Washington, D. C.1995Google Scholar, 14Ramsden D.A. Gellert M. EMBO J. 1998; 17: 609-614Crossref PubMed Scopus (248) Google Scholar, 15Chen F. Peterson S.R. Story M.D. Chen D.J. Mutat. Res. 1996; 362: 9-19Crossref PubMed Scopus (67) Google Scholar, 16Rathmell W.K. Chu G. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 7623-7627Crossref PubMed Scopus (195) Google Scholar, 17Blunt T. Gell D. Fox M. Taccioli G.E. Lehmann A.R. Jackson S.P. Jeggo P.A. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 10285-10290Crossref PubMed Scopus (309) Google Scholar). Ku70/80 complex dihydrouracil In this study, we show that Ku binds to a nick opposite of DHU, leading to an inhibition of endonuclease III activity. Furthermore, we show that the presence of Ku at the nick helps to prevent the formation of free double strand breaks by tethering the new ends generated by endonuclease III-induced cleavage. Based on these observations, we suggest that the formation of the DNA-Ku complex immediately after the enzymatic processing of the closely opposed lesion is important for channeling the double strand break directly to the end-joining reaction to avoid the possibility of aberrant recombination through the misjoining of different molecules containing double strand breaks. All oligonucleotides were obtained from Operon and purified by polyacrylamide gel (15%) electrophoresis as described previously (18Yao M. Kow Y.W. J. Biol. Chem. 1995; 270: 28609-28616Abstract Full Text Full Text PDF PubMed Scopus (45) Google Scholar). Oligonucleotides containing DHU were 5′-end-labeled with [γ-32P]ATP (Amersham Pharmacia Biotech) using T4 polynucleotide kinase or 3′-end-labeled with [α-32P]cordycepin 5′-triphosphate (PerkinElmer Life Sciences) using terminal deoxynucleotidyltransferase following the instructions from the enzyme supplier (U.S. Biochemical Corp.). Labeled oligonucleotides containing DHU were annealed to the appropriate complementary strands at 1:1.5 ratio in 10 mmTris-HCl, pH 7.5, 0.1 m NaCl, and 2 mm2-mercaptoethanol by heating the mixture to 90 °C and cooling down gradually to room temperature. The following oligonucleotide duplexes were used in this study (Q represents dihydrouracil): Duplex N: 5′-CACCCGTCTACTCCAQCC-CAACCAACCGTGTATTCTATAGTGCACCTGGTTC GTGGGCAGATGAGGTGGG GTTGGTTGGCACATAAGATATCACGTGGATTAAG Duplex L: 5′-CACCCGTCTACTCCAQCCCAACCAACCGTGTATTCTATAGTGCACCTGGTTC GTGGGCAGATGAGGTGGGGTTGGTTGGCACATAAGATATCACGTGGATTAAG Duplex N contained a DHU that was placed three nucleotides 5′ to a nick on the opposite strand. It is expected that incubating duplex N with endonuclease III at room temperature will generate a double strand break. Duplex L differed from duplex N only in that it lacked a nick. Incubating duplex L with endonuclease III should generate a single strand break in the DNA. Escherichia coliendonuclease III was purified from an overproducing strain employing MonoS, MonoQ and phenyl-Sepharose column chromatography as described previously (19Asahara H. Wistort P.M. Bank J.F. Bakerian R.H. Cunningham R.P. Biochemistry. 1989; 10: 4444-4449Crossref Scopus (213) Google Scholar). Human endonuclease III was purified by Dr. Robindra Roy (20Ikeda S. Biswas T. Roy R. Izumi T. Boldogh I. Kurosky A. Sarker A.H. Seki S. Mitra S. J. Biol. Chem. 1998; 273: 21585-21593Abstract Full Text Full Text PDF PubMed Scopus (224) Google Scholar). Ku was purified by Dr. David Chen according to an earlier published procedure (21Cary R.B. Peterson S.R. Wang J. Bear D.G. Bradbury E.M. Chen D.J. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 4267-4272Crossref PubMed Scopus (225) Google Scholar). Endonuclease III was assayed in a standard reaction buffer (10 μl) containing 0.1 m KCl, 10 mm Tris-HCl, pH 7.5, 20 fmol of DNA substrate, and 20 fmol of endonuclease III. The reaction was performed at 37 °C for 10 min (22Kow Y.W. Wallace S.S. Biochemistry. 1987; 26: 8200-8206Crossref PubMed Scopus (156) Google Scholar). The reaction was stopped with 10 μl of polyacrylamide gel-loading buffer (90% formamide, 1 mm EDTA, 0.1% xylene, and 0.1% bromphenol blue) and heated to 90 °C for 10 min. 3–5 μl of the reaction were loaded onto a 12.5% denaturing polyacrylamide gel and electrophoresed at 2000 V for 1.5 h. The polyacrylamide gel was then dried, and the amount of endonuclease III-induced nicks was estimated by using the STORM PhosphorImager (Molecular Dynamics). To determine the amount of double strand breaks induced by endonuclease III, at the end of 10 min of incubation, reactions were stopped with the gel-loading buffer and then assayed with 10% nondenaturing polyacrylamide gel. The double strand break assay is identical to the electrophoretic mobility shift assay described below. The binding reaction (10 μl) was performed in a standard endonuclease III reaction mixture containing 0.1 m KCl, 10 mm Tris-HCl, pH 7.5, 20 fmol of DNA substrate, and increasing amounts of Ku (10–300 fmol). In some reactions, 20 fmol of endonuclease III were added. After 10 min at 37 °C, 5 μl of the reaction mixtures were added to 5 μl of polyacrymide gel-loading buffer and heated to 90 °C for 10 min. The amount of endonuclease III-induced nicks was assayed as described in the previous section. The remainder (5 μl) of the binding reaction was subjected immediately to electrophoretic mobility shift assay as described below. Electrophoretic mobility shift assay was performed with a 10% polyacrylamide gel containing acrylamide/N,N′-methylenebisacrylamide at 19.76/0.24 ratio as described previously (18Yao M. Kow Y.W. J. Biol. Chem. 1995; 270: 28609-28616Abstract Full Text Full Text PDF PubMed Scopus (45) Google Scholar). The gels were pre-electrophoresed in TBE buffer (89 mm Tris, 89 mm boric acid, pH 8.3 and 2.5 mm EDTA) at 300 V (4 °C) for 30 min. Samples were loaded onto the gel, and electrophoresis was continued at 300 V (4 °C) for an additional 150 min. After electrophoresis, the gels were dried under vacuum and exposed to x-ray film. The radioactive bands in the dried gels were quantified with the STORM PhosphorImager. Dihydrouracil, a product of the anoxic radiolysis of deoxycytidine is readily recognized by human and E. coliendonuclease III (20Ikeda S. Biswas T. Roy R. Izumi T. Boldogh I. Kurosky A. Sarker A.H. Seki S. Mitra S. J. Biol. Chem. 1998; 273: 21585-21593Abstract Full Text Full Text PDF PubMed Scopus (224) Google Scholar). To examine the role of Ku in the repair of closely opposed lesions, duplex N that contained a DHU in close proximity opposite to a nick was used as a substrate for endonuclease III. Endonuclease III-induced cleavage of the DNA strand containing DHU of duplex N will generate an additional nick opposite to the pre-existing nick that is separated from each other by only three nucleotides. At room temperature, this will result in a double strand break that can be detected by electrophoresis in a nondenaturing polyacrylamide gel. Ku is known to bind to DNA ends and nicks (23Rathmell W.K. Chu G. Nickoloff J.A. Hoekstra M.F. DNA Damage and Repair: DNA Repair in Higher Eukaryotes. Humana Press Inc., Scholar, J. Biol. Chem. 1997; Full Text Full Text PDF PubMed Scopus (70) Google and it might with endonuclease III activity on duplex In Ku would be expected to or no effect on the cleavage activity of endonuclease III on duplex L. 1 the effect of Ku on the human endonuclease III activity on DNA duplex L in the strands were at 5′ ends Ku is known to bind to only DNA ends and nicks and has not shown to endonuclease activity. 1 that incubating with increasing amounts of Ku not to an nicking of duplex L 1 small amount of cleavage was observed with the DNA Ku not no double strand breaks were observed in the presence of increasing amounts of Ku 1 strand break was assayed by the formation of a than the free DNA substrate. strand break formation was assayed with nondenaturing polyacrylamide gel electrophoresis, an assay that is identical to the electrophoretic mobility shift assay used for the Ku-DNA these electrophoresis the Ku-DNA complexes that than the free DNA substrate were readily Incubating duplex L with human endonuclease III to a cleavage at the dihydrouracil lesion 1 however, incubating endonuclease III with increasing of Ku or no effect on the human endonuclease activity on duplex L 1 cleavage of duplex L by human endonuclease III will only to a nick in a duplex no amount of double strand breaks was observed when duplex L was with endonuclease III 1 However, when duplex N was used as a substrate, low of Ku effect on the human endonuclease III activity 1 with however, at of Ku the inhibition of human endonuclease III activity was observed 2 1 with At low of the observed activity of human endonuclease III was also by a concomitant of free double strand breaks 2 1 with of Ku were found to the nicking of duplex the formation of free double strand breaks was also inhibited at Ku of Ku on human endonuclease III activity on duplex is identical to that of that duplex N was used as the DNA Similar results were also obtained with E. coli endonuclease III with the that increasing of Ku to a effect on duplex L and duplex N the results obtained for human endonuclease III, increasing of Ku not to an of double strand breaks with duplex L increasing Ku to an inhibition of double strand breaks formation induced by E. coli endonuclease III of Ku on E. coliendonuclease III activity on duplex is identical to that of that human endonuclease III was with E. coli endonuclease III on duplex The gel in are To of these observations, these were three and the amount of endonuclease III-induced nicks and double strand breaks was quantified using a PhosphorImager. The amount of nicks or double strand breaks generated by endonuclease III was the amount of Ku the 5 that increasing of Ku no effect on the human endonuclease III activity on duplex at human endonuclease III. low of Ku not the human endonuclease III activity on duplex N 5 however, at of Ku the inhibition of human endonuclease III activity was observed 5 It is important to that at low of the observed human endonuclease III activity on duplex N was by the formation of free double strand breaks induced by endonuclease however, at of the formation of free double strand breaks was inhibited to a greater than the of nicks by human endonuclease III 5 At fmol of Ku of Ku70/80 endonuclease human endonuclease III-nicking activity was inhibited by however, at the the formation of free double strand breaks was inhibited by The observed the amount of human endonuclease III-induced nicks and free double strand breaks that in the presence of a amount of the double strand breaks induced by human endonuclease III not result in free double strand breaks but was and by Ku as a DNA-Ku complex. Similar results were also obtained with E. coli endonuclease III with the that Ku to a effect 5 At of coli endonuclease III activity was inhibited for duplexes L and N 5 Similar to the results obtained for human endonuclease III, the increasing of Ku to a much greater inhibition of the amount of free double strand breaks formed as compared with the amount of nicks generated by E. coli endonuclease III 5 show that the amount of free double strand breaks not to the amount of nicks induced by human and E. coli III in duplex that of the double strand breaks were and by Ku as DNA-protein nondenaturing it is that Ku complexes with duplexes N and L These DNA-Ku complexes were observed as than the substrate DNA. It is known that Ku will bind to the of a double-stranded DNA as a DNA-protein complex. In Ku can along the DNA E. W. J. Mol. Biol. 1989; PubMed Scopus Google additional Ku molecules to bind to the free DNA a Ku binds to a double-stranded DNA on a and generates Ku-DNA protein Ku a it is that a duplex DNA can with complexes containing or Ku E. W. J. Mol. Biol. 1989; PubMed Scopus Google P. P. Chen D.J. J. Mol. Biol. 1998; PubMed Scopus Google Scholar, J. J.A. J. Biol. Chem. Full Text PDF PubMed Google Scholar, S. F. Nucleic Acids Res. PubMed Scopus Google Scholar). endonuclease III reactions were performed at 37 °C, the binding were also performed at 37 In the of endonuclease III incubating duplex oligonucleotides with three bands and were observed and and It is to that at 37 °C and at Ku protein or no binding of the Ku complex to duplex oligonucleotides was observed However, when binding reactions were performed at 20 °C, the formation of complexes and can be readily observed at 10 fmol of Ku not the incubating duplex oligonucleotides with endonuclease III and increasing of Ku also generated three DNA-Ku complexes To a on the of Ku with duplexes N and each of the radioactive bands to the of Ku-DNA complexes was quantified using a PhosphorImager and as a of Ku that when duplex L was used as a DNA substrate, or no binding of Ku to DNA was observed at Ku At 300 fmol of of the DNA was with molecules of Ku at each end of the DNA. amount of complex was It is to that under the reaction the amount of complex formed was than the amount of complex I. duplex N is nucleotides it is that the binding of Ku molecules to the DNA might the Ku leading to for the DNA-Ku complex as compared with DNA-Ku complex I. a small amount of complex III was formed at In the presence of human endonuclease III the of Ku with the DNA substrate to an increase in complex and as much as of DNA was as complex increase in the of complex was also observed with E. coli endonuclease III It is that the binding of endonuclease III at the nick by the of endonuclease or DHU lesion helps to complex leading to an increase in the amount of complex when endonuclease III is present. However, the of complexes and were by the presence of either human or E. coli endonuclease III In the of endonuclease III, the binding of Ku to duplex N was to that observed for duplex L. binding of Ku to duplex N was observed at of Ku-DNA complex were observed at of Ku not The formation of and complexes was readily the III complex was only observed at of Ku. incubating duplex N with human endonuclease III and increasing the amounts of Ku to a increase in the formation of complex and a increase in that of complex not the formation of free double strand breaks. The the formation of complex and the in the of free double strand that the double strand breaks formed were by Ku and as DNA-protein Similar results were also observed with E. coli endonuclease III not It was shown earlier that base excision repair enzymes, such as III and and formamidopyrimidine-N-glycosylase, can 1 of 2 closely opposed base lesions (8Chaudhry M.A. Weinfeld M. J. Mol. Biol. 1995; 249: 914-922Crossref PubMed Scopus (105) Google Scholar, 9Harrison L. Hatahet Z. Purmal A.A. Wallace S.S. Nucleic Acids Res. 1998; 26: 932-941Crossref PubMed Scopus (111) Google and a nick close to the lesion on the opposite strand. The of the base lesion is inhibition was thought to be important to reduce the possibility of free double strand breaks by these repair However, or the of amounts of these can closely opposed lesions in DNA to frank double strand breaks. In double strand breaks are primarily repaired by the nonhomologous end-joining involving Ku (13Freidberg E.C. Walker G.C. Siede W. DNA Repair and Mutagenesis . American Society of Microbiology Press, Washington, D. C.1995Google Scholar, 14Ramsden D.A. Gellert M. EMBO J. 1998; 17: 609-614Crossref PubMed Scopus (248) Google Scholar, 15Chen F. Peterson S.R. Story M.D. Chen D.J. Mutat. Res. 1996; 362: 9-19Crossref PubMed Scopus (67) Google Scholar, 16Rathmell W.K. Chu G. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 7623-7627Crossref PubMed Scopus (195) Google Scholar, 17Blunt T. Gell D. Fox M. Taccioli G.E. Lehmann A.R. Jackson S.P. Jeggo P.A. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 10285-10290Crossref PubMed Scopus (309) Google Scholar). free double strand breaks are repaired readily in mammalian cells, it is to avoid this formation to reduce the of might result in In the processing of closely opposed base lesions, a nick is generated in close proximity opposite to the base We that Ku binds to duplex N and endonuclease III activity on DHU lesion opposite to a that Ku might a role in the repair of closely opposed base lesions. It has estimated that a human has as as molecules of Ku J. Biol. Chem. 1997; Full Text Full Text PDF PubMed Scopus (70) Google Scholar). it is that the Ku is in endonuclease III and other repair results suggest that in Ku will the of endonuclease III on a lesion opposite to a nick. It is also to that Ku was demonstrated to the binding of excision repair to a linear DNA J. J.A. J. Biol. Chem. Full Text PDF PubMed Google Scholar). We suggest that the binding of Ku to the DNA will either help to DNA and to the nick or for these to repair the intermediary nick. model for the role of Ku in the of repair of the closely opposing lesion is in It has shown that the binding of Ku to a nick not the reaction by either DNA or III. In the binding of Ku these reactions D.A. Gellert M. EMBO J. 1998; 17: 609-614Crossref PubMed Scopus (248) Google Scholar). Recently, Ku-DNA complex was shown to DNA and also directly with the human DNA L. P. J. Biol. Chem. 2000; 275: Full Text Full Text PDF PubMed Scopus Google Scholar, J. D.A. Mol. Biol. 2000; PubMed Scopus Google Scholar). However, it is not known the binding of Ku to a nick will the rate of repair by DNA the nick is Ku should from the excision of the base lesion by human endonuclease III. However, the of the lesion the nicks are double strand DNA breaks generated will be by Ku and directly the end-joining repair In that no intermediary free double strand breaks are the possibility of the misjoining of DNA We Dr. for of the
Récupéré en direct depuis OpenAlex et désinversé. Les résumés ne sont pas conservés dans cette base de données : les index inversés représentent 8,6 Go des 9,3 Go de texte de la base, et le serveur dispose de 13 Go libres.
Comment cette classification a été obtenuedéplier
Prédiction distillée sur la base complète
Imitation des enseignantsNi prévalence calibrée, ni vérité terrain. Validation humaine à venir. Apprise à partir de 10 348 étiquettes directes de Codex et de 10 348 étiquettes directes de Gemma. Le mode candidate est l'union des têtes enseignantes seuillées; le consensus est leur intersection. Ces sorties portent le statut machine_predicted_unvalidated et ne sont ni des étiquettes humaines ni des étiquettes directes de modèles de pointe.
Scores Codex et Gemma par catégorie
| Catégorie | Codex | Gemma |
|---|---|---|
| Métarecherche | 0,001 | 0,001 |
| Méta-épidémiologie (sens strict) | 0,000 | 0,000 |
| Méta-épidémiologie (sens large) | 0,000 | 0,000 |
| Bibliométrie | 0,000 | 0,000 |
| Études des sciences et des technologies | 0,000 | 0,000 |
| Communication savante | 0,000 | 0,000 |
| Science ouverte | 0,000 | 0,000 |
| Intégrité de la recherche | 0,000 | 0,000 |
| Charge utile insuffisante (le modèle a refusé de juger) | 0,000 | 0,000 |
Scores machine (provisoires)
Les deux têtes enseignantes du modèle étudiant, lues sur ce travail. Un score ordonne la base pour la relecture; il n'affirme jamais une catégorie, et le statut de validation accompagne chaque rangée tel quel.
Scores de référence d'un modèle non mature (critères de maturité non atteints, 7 itérations). Un score ordonne; il n'affirme jamais une catégorie.
score_only:v0-immature-baseline · tel quel depuis la passe de notation : score_only signifie que le nombre peut ordonner les travaux, et qu'aucune étiquette de catégorie n'en découleClassification
machine, non validéePrédiction automatique; un appel candidat d’une seule tête enseignante, pas un consensus.
Le détail, modèle par modèle et score par score, se trouve en fin de page sous « Comment cette classification a été obtenue ».