MétaCan
Menu
Retour à la cohorte
Enregistrement W2021373661 · doi:10.1074/jbc.m304053200

Characterization of the Catalase-Peroxidase KatG from Burkholderia pseudomallei by Mass Spectrometry

2003· article· en· W2021373661 sur OpenAlexaff
Lynda J. Donald, Oleg V. Krokhin, Harry W. Duckworth, Benjamin Wiseman, Taweewat Deemagarn, Rahul Singh, Jack Switala, X. Carpena, Ignacio Fita, P.C. Loewen

Notice bibliographique

RevueJournal of Biological Chemistry · 2003
Typearticle
Langueen
DomaineAgricultural and Biological Sciences
ThématiqueEnzyme-mediated dye degradation
Établissements canadiensUniversity of Manitoba
Organismes subventionnairesnon disponible
Mots-clésBurkholderia pseudomalleiCatalasePeroxidaseMicrobiologyChemistryMass spectrometryBurkholderiaBiochemistryBiologyEnzymeBacteriaChromatography

Résumé

récupéré en direct d'OpenAlex

The electron density maps of the catalase-peroxidase from Burkholderia pseudomallei (BpKatG) presented two unusual covalent modifications. A covalent structure linked the active site Trp111 with Tyr238 and Tyr238 with Met264, and the heme was modified, likely by a perhydroxy group added to the vinyl group on ring I. Mass spectrometry analysis of tryptic digests of BpKatG revealed a cluster of ions at m/z 6585, consistent with the fusion of three peptides through Trp111, Tyr238, and Met264, and a cluster at m/z ∼4525, consistent with the fusion of two peptides linked through Trp111 and Tyr238. MS/MS analysis of the major ions at m/z 4524 and 4540 confirmed the expected sequence and suggested that the multiple ions in the cluster were the result of multiple oxidation events and transfer of CH3-S to the tyrosine. Neither cluster of ions at m/z 4525 or 6585 was present in the spectrum of a tryptic digest of the W111F variant of BpKatG. The spectrum of the tryptic digest of native BpKatG also contained a major ion for a peptide in which Met264 had been converted to homoserine, consistent with the covalent bond between Tyr238 and Met264 being susceptible to hydrolysis, including the loss of the CH3-S from the methionine. Analysis of the tryptic digests of hydroperoxidase I (KatG) from Escherichia coli provided direct evidence for the covalent linkage between Trp105 and Tyr226 and indirect evidence for a covalent linkage between Tyr226 and Met252. Tryptic peptide analysis and N-terminal sequencing revealed that the N-terminal residue of BpKatG is Ser22. The electron density maps of the catalase-peroxidase from Burkholderia pseudomallei (BpKatG) presented two unusual covalent modifications. A covalent structure linked the active site Trp111 with Tyr238 and Tyr238 with Met264, and the heme was modified, likely by a perhydroxy group added to the vinyl group on ring I. Mass spectrometry analysis of tryptic digests of BpKatG revealed a cluster of ions at m/z 6585, consistent with the fusion of three peptides through Trp111, Tyr238, and Met264, and a cluster at m/z ∼4525, consistent with the fusion of two peptides linked through Trp111 and Tyr238. MS/MS analysis of the major ions at m/z 4524 and 4540 confirmed the expected sequence and suggested that the multiple ions in the cluster were the result of multiple oxidation events and transfer of CH3-S to the tyrosine. Neither cluster of ions at m/z 4525 or 6585 was present in the spectrum of a tryptic digest of the W111F variant of BpKatG. The spectrum of the tryptic digest of native BpKatG also contained a major ion for a peptide in which Met264 had been converted to homoserine, consistent with the covalent bond between Tyr238 and Met264 being susceptible to hydrolysis, including the loss of the CH3-S from the methionine. Analysis of the tryptic digests of hydroperoxidase I (KatG) from Escherichia coli provided direct evidence for the covalent linkage between Trp105 and Tyr226 and indirect evidence for a covalent linkage between Tyr226 and Met252. Tryptic peptide analysis and N-terminal sequencing revealed that the N-terminal residue of BpKatG is Ser22. The heme-containing catalase-peroxidases are bifunctional enzymes that degrade hydrogen peroxide either as a catalase (2H2O2 → 2H2O + O2) or as a peroxidase (H2O2 + 2AH → 2H2O + 2A•). The catalatic reaction, with a more rapid turnover rate, dominates over the peroxidatic reaction, and the in vivo peroxidatic substrate remains unidentified, suggesting that the main role of the enzyme is the removal of H2O2, preventing the formation of highly reactive and damaging breakdown products of H2O2. However, the enzyme has a close sequence resemblance to plant peroxidases (1Heym B. Alzari P.M. Honoré N. Cole S.T. Mol. Microbiol. 1995; 15: 235-245Crossref PubMed Scopus (311) Google Scholar, 2Welinder K.G. Biochim. Biophys. Acta. 1991; 1080: 215-220Crossref PubMed Scopus (150) Google Scholar), and it remains a possibility that the peroxidatic reaction has a metabolic significance outside of degrading H2O2. Indeed, it is clear that the catalatic function evolved as an adaptation of the peroxidatic function because the simple change of a tryptophan to a phenylalanine in the distal heme pocket reduces catalatic activity by 1000-fold (of Escherichia coli HPI) and increases peroxidatic activity by 3-fold (3Hillar A. Peters B. Pauls R. Loboda A. Zhang H. Mauk A.G. Loewen P.C. Biochemistry. 2000; 39: 5868-5875Crossref PubMed Scopus (95) Google Scholar, 4Regelsberger G. Jakopitsch C. Ruker F. Krois D. Peschek G.A. Obinger C. J. Biol. Chem. 2000; 275: 22854-22861Abstract Full Text Full Text PDF PubMed Scopus (72) Google Scholar, 5Regelsberger G. Jakopitsch C. Furtmuller P.G. Rueker F. Switala J. Loewen P.C. Obinger C. Biochem. Soc. Trans. 2001; 29: 99-105Crossref PubMed Google Scholar). Furthermore, the core structures of both the N- and C-terminal domains of the catalase-peroxidases from Haloarcula marismortui and Burkholderia pseudomallei closely resemble the structure of plant peroxidases (6Yamada Y. Fujiwara T. Sato T. Igarashi N. Tanaka N. Nat. Struct. Biol. 2002; 9: 691-695Crossref PubMed Scopus (140) Google Scholar, 7Carpena X. Lopraesert S. Mongkolsuk S. Switala J. Loewen P.C. Fita I. J. Mol. Biol. 2003; 327: 475-489Crossref PubMed Scopus (123) Google Scholar). Finally, the conversion of isoniazid into its active antitubercular form by KatG of Mycobacterium tuberculosis is clearly a result of the peroxidatic reaction using isonicotinic acid hydrazide (INH) 1The abbreviations used are: INH, isonicotinic acid hydrazide; MALDI, matrix-assisted laser desorption ionization; MS, mass spectrometry; HPLC, high pressure liquid chromatography; HPI, hydroperoxidase I.1The abbreviations used are: INH, isonicotinic acid hydrazide; MALDI, matrix-assisted laser desorption ionization; MS, mass spectrometry; HPLC, high pressure liquid chromatography; HPI, hydroperoxidase I. as a substrate that must mimic the actual in vivo substrate. The structures of the catalase-peroxidases from H. marismortui and B. pseudomallei have been reported (6Yamada Y. Fujiwara T. Sato T. Igarashi N. Tanaka N. Nat. Struct. Biol. 2002; 9: 691-695Crossref PubMed Scopus (140) Google Scholar, 7Carpena X. Lopraesert S. Mongkolsuk S. Switala J. Loewen P.C. Fita I. J. Mol. Biol. 2003; 327: 475-489Crossref PubMed Scopus (123) Google Scholar) and have revealed several features that are, so far, unique to this class of enzyme. Present in both structures is an unusual adduct or covalent linkage among the side chains of a tryptophan, a tyrosine, and a methionine (see Fig. 1). The likely mechanistic significance of the covalent structure is enhanced by the fact that the tryptophan lies in the active site and is essential for catalatic activity. A second feature, evident only in the structure of BpKatG, is a modification to the heme, likely a hydroperoxide group added to ring I of the heme in close proximity to the Trp-Tyr-Met adduct. This paper presents mass spectrometry evidence supportive of the existence of the Trp-Tyr-Met adduct originally deduced from the electron density maps of HmCPx and BpKatG (6Yamada Y. Fujiwara T. Sato T. Igarashi N. Tanaka N. Nat. Struct. Biol. 2002; 9: 691-695Crossref PubMed Scopus (140) Google Scholar, 7Carpena X. Lopraesert S. Mongkolsuk S. Switala J. Loewen P.C. Fita I. J. Mol. Biol. 2003; 327: 475-489Crossref PubMed Scopus (123) Google Scholar). Materials—Standard chemicals and biochemicals were obtained from Sigma. Restriction endonucleases, polynucleotide kinase, DNA ligase, and the Klenow fragment of DNA polymerase were obtained from Invitrogen. Strains and Plasmids—The plasmid pBG306 encoding BpKatG (8Loewen P.C. Switala J. Smolenski M. Triggs-Raine B.L. Biochem. Cell Biol. 1990; 68: 1037-1044Crossref PubMed Scopus (30) Google Scholar) and the plasmids pAH8 and pW105F encoding KatG (HPI) and its W105F variant from E. coli (3Hillar A. Peters B. Pauls R. Loboda A. Zhang H. Mauk A.G. Loewen P.C. Biochemistry. 2000; 39: 5868-5875Crossref PubMed Scopus (95) Google Scholar) were transformed into strain UM262 pro leu rpsL hsdM hsdR endI lacY katG2 katE12::Tn10 recA (8Loewen P.C. Switala J. Smolenski M. Triggs-Raine B.L. Biochem. Cell Biol. 1990; 68: 1037-1044Crossref PubMed Scopus (30) Google Scholar) for expression of the katG constructs and isolation of the mutant KatG proteins. Phagemids pKS+ and pKS– from Stratagene Cloning Systems were used for mutagenesis, sequencing, and cloning. E. coli strains NM522 (supE thi)(lac-proAB) hsd-5 [F′ proAB lacI q lacZ)15]) (9Mead D.A. Skorupa E.S. Kemper B. Nucleic Acids Res. 1985; 13: 1103-1118Crossref PubMed Scopus (81) Google Scholar), JM109 (recA1 supE44 endA1 hsdR17 gyrA96 relA1 thi) (lac-proAB) (10Yanisch-Perron C. Vietra J. Messing J. Gene (Amst.). 1985; 33: 103-119Crossref PubMed Scopus (11457) Google Scholar), and CJ236 (dut-1 ung-1 thi-1 relA1/pCJ105 F′) (11Kunkel T.A. Roberts J.D. Zakour R.A. Methods Enzymol. 1987; 154: 367-382Crossref PubMed Scopus (4558) Google Scholar) were used as hosts for the plasmids and for generation of single-stranded phage DNA using helper phage R408. Oligonucleotide-directed Mutagenesis—The oligonucleotides CTGTTCATCAAAATGGCATGG (AAA encoding Lys in place of Arg108), CGCATGGCATTTCACAGCGCG (TTT encoding Phe in place of Trp111), and TTCGCGCGCCTGGCGATGAAC (CTG encoding Leu in place of Met264) were purchased from Invitrogen. They were used to mutagenize a 600-bp fragment from pBG306 generated by KpnI-ClaI restriction following the Kunkel procedure (11Kunkel T.A. Roberts J.D. Zakour R.A. Methods Enzymol. 1987; 154: 367-382Crossref PubMed Scopus (4558) Google Scholar), which was subsequently reincorporated into pBG306 to generate the mutagenized katG gene. Sequence confirmation of all sequences was by the Sanger method (12Sanger F.S. Nicklen S. Coulsen A.R. Proc. Natl. Acad. Sci. U. S. A. 1977; 74: 5463-5467Crossref PubMed Scopus (52602) Google Scholar) on double-stranded plasmid DNA generated in JM109. Subsequent expression and purification were carried out as described previously (3Hillar A. Peters B. Pauls R. Loboda A. Zhang H. Mauk A.G. Loewen P.C. Biochemistry. 2000; 39: 5868-5875Crossref PubMed Scopus (95) Google Scholar, 8Loewen P.C. Switala J. Smolenski M. Triggs-Raine B.L. Biochem. Cell Biol. 1990; 68: 1037-1044Crossref PubMed Scopus (30) Google Scholar). The catalase- and peroxidase-specific activities of the variants compared with the native BpKatG are summarized in Table I.Table ICharacterization of BpKatG and its variantsVariantCatalasePeroxidaseunits/mgunits/mgBpKatG10101.1R108K900.55W111F1.30.33M264L2.41.3 Open table in a new tab Catalase, Peroxidase, Protein, and Spectral Determination—Catalase activity was determined by the method of Rørth and Jensen (13Rørth M. Jensen P.K Biochim. Biophys. Acta. 1967; 139: 171-173Crossref PubMed Scopus (113) Google Scholar) in a Gilson oxygraph equipped with a of catalase is as the that of in in a at at was to the by E. Methods Enzymol. Scopus Google Scholar). activity was determined by the method of N. S. M. J. Biol. Chem. 1990; Full Text PDF PubMed Google Scholar). of peroxidase is as the that of acid in at were obtained using a The were in N-terminal N-terminal sequence was determined by the at the Mass mass was into The were by in an mass K.G. J. Soc. Mass 9: Scopus Google Scholar, K.G. Chem. PubMed Scopus Google Scholar). The was to the of the of the were using and on the M. K.G. Mass 2000; PubMed Scopus Google Scholar). analysis was with of and acid in a was by on the The were a and with a of was at by the the of tryptic were in were the as described of the Trp-Tyr-Met in existence of a covalent structure the side chains of Trp111, Tyr238, and Met264 in BpKatG was originally deduced from the electron density maps from of both HmCPx (6Yamada Y. Fujiwara T. Sato T. Igarashi N. Tanaka N. Nat. Struct. Biol. 2002; 9: 691-695Crossref PubMed Scopus (140) Google Scholar) and BpKatG X. Lopraesert S. Mongkolsuk S. Switala J. Loewen P.C. Fita I. J. Mol. Biol. 2003; 327: 475-489Crossref PubMed Scopus (123) Google Scholar). the existence of an unusual the peptide generated by of BpKatG was by mass of the in the structure is on a tryptic peptide and the of with the of of mass the of the adduct of the peptides by mass spectrometry from both BpKatG and its W111F variant are in Table the expected fragment at m/z is from the BpKatG the ion in the spectrum of the W111F to m/z by the to Phe is clearly The ions at m/z Met264) and m/z are present in the of both BpKatG and its W111F are in the Furthermore, two of ions are evident in the BpKatG spectrum that are present in the W111F m/z 4525 and m/z 6585, close to the for peptides in the and Trp-Tyr-Met The of the ions of the adduct at m/z 6585 analysis by The cluster of ions to the adduct at m/z 4525 a of by of at m/z with two ions at m/z 4524 and ions were by MS/MS a of consistent with the structure and Table with of and in the ions at m/z 4524 and two for the mass are is that two or three are added with the loss of or and this is in by the oxidation of the ring of Trp111 evident in the electron density The second is that the of the covalent bond in the CH3-S or from the methionine being to the tyrosine, to the in of the a of ions multiple and the CH3-S group is to the of the or more ions in the cluster m/z 4525 and the of and expected + + of ions from the tryptic digest of BpKatG and its W111F ion in in by of m/z of the cluster is in the ion in a of ions the of The of of the is by the fact that ion two from loss of and loss of to three of ions by and The is by the possibility that CH3-S also a adduct of and m/z of the cluster is in the ion in a of ions the of The of of the is by the fact that ion two from loss of and loss of to three of ions by and The is by the possibility that CH3-S also a oxidation of m/z of the cluster is in the ion in a of ions the of The of of the is by the fact that ion two from loss of and loss of to three of ions by and The is by the possibility that CH3-S also a oxidation of m/z of the cluster is in the ion in a of ions the of The of of the is by the fact that ion two from loss of and loss of to three of ions by and The is by the possibility that CH3-S also a CH3-S added to m/z of the cluster is in the ion in a of ions the of The of of the is by the fact that ion two from loss of and loss of to three of ions by and The is by the possibility that CH3-S also a m/z of the cluster is in the ion in a of ions the of The of of the is by the fact that ion two from loss of and loss of to three of ions by and The is by the possibility that CH3-S also a ion of and m/z of the cluster is in the ion in a of ions the of The of of the is by the fact that ion two from loss of and loss of to three of ions by and The is by the possibility that CH3-S also a m/z of the cluster is in the ion in a of ions the of The of of the is by the fact that ion two from loss of and loss of to three of ions by and The is by the possibility that CH3-S also a ion of and m/z of the cluster is in the ion in a of ions the of The of of the is by the fact that ion two from loss of and loss of to three of ions by and The is by the possibility that CH3-S also a ion of and m/z of the cluster is in the ion in a of ions the of The of of the is by the fact that ion two from loss of and loss of to three of ions by and The is by the possibility that CH3-S also a adduct of and m/z of the cluster is in the ion in a of ions the of The of of the is by the fact that ion two from loss of and loss of to three of ions by and The is by the possibility that CH3-S also a Open table in a new tab Fig. m/z of from tryptic digests of native BpKatG and its W111F the spectrum of of the digest of native BpKatG a cluster of ions at m/z in the by the covalent linkage between Trp111 and Tyr238. A cluster of ions is also evident at m/z 6585, consistent with the of the covalent between Trp111 and Tyr238 and between Tyr238 and the spectrum of of the digest of the W111F variant the ion cluster at m/z The ions present in this in and are present at (see MS/MS analysis of the ion at m/z 4524 from A. The of the to the ions are by a and ion or the sequence The ions and and all of the are expected from the sequence the to ions with the expected The fragment are summarized in Table The ion at m/z was of expected and + + of ions in the MS/MS spectrum of the ion at m/z 4524 in Fig. and in the MS/MS spectrum of the ion at m/z Open table in a new tab Fig. for of the covalent bond Tyr238 and Met264 from The transfer of the CH3-S to the is clear indirect evidence for the of a covalent linkage between Tyr238 and Met264 that was mass spectrometry analysis and that the of the methionine present in of the The expected ion for the peptide at m/z is present in the of both BpKatG and the W111F variant is by an ion at m/z only in the BpKatG spectrum A and MS/MS analysis of the ions at m/z and and and Table the sequence in which has the mass for in the ion at m/z has a mass in the ion at m/z the of the ion at m/z all of the the N-terminal are the expected all of the with the of are in with the expected m/z as homoserine, which from of the covalent bond and which has a mass that of the mass between the ions at m/z and m/z this indirect evidence for the covalent between Tyr238 and of expected and + + of ions in the MS/MS in Fig. and Open table in a new tab of the Trp-Tyr-Met in of the covalent adduct in catalase-peroxidases from two as the H. marismortui and the B. pseudomallei suggested that it a to all This was in an analysis of the tryptic digest of (KatG) from E. coli and its W105F variant three of the Trp105 and Tyr226 are with confirmed by MS/MS this that the adduct present in HPI, a cluster of also by is evident m/z in the digest of native in the digest of the W105F variant Analysis of the ion by MS/MS a consistent with the of the covalent structure The of the either from the of CH3-S for or oxidation for three for to the fragment by ions and and Table ions at m/z of the and m/z of to homoserine, were the only evidence for the of the adduct in the of CH3-S in the ion at m/z and expected + + of ions from the tryptic digest of and its W105F ion in in by oxidation of mass of the cluster is in the ion in a of ions the of The of of the is by the fact that ion two from loss of and loss of to three of ions by and The is by the possibility that CH3-S also a adduct of and mass of the cluster is in the ion in a of ions the of The of of the is by the fact that ion two from loss of and loss of to three of ions by and The is by the possibility that CH3-S also a mass of the cluster is in the ion in a of ions the of The of of the is by the fact that ion two from loss of and loss of to three of ions by and The is by the possibility that CH3-S also a CH3-S added to mass of the cluster is in the ion in a of ions the of The of of the is by the fact that ion two from loss of and loss of to three of ions by and The is by the possibility that CH3-S also a ion of and mass of the cluster is in the ion in a of ions the of The of of the is by the fact that ion two from loss of and loss of to three of ions by and The is by the possibility that CH3-S also a ion of and mass of the cluster is in the ion in a of ions the of The of of the is by the fact that ion two from loss of and loss of to three of ions by and The is by the possibility that CH3-S also a Open table in a new tab Table of expected and + + of ions in the MS/MS spectrum in Fig. Open table in a new tab of the of N-terminal by the DNA sequence were evident in the electron density maps of BpKatG X. Lopraesert S. Mongkolsuk S. Switala J. Loewen P.C. Fita I. J. Mol. Biol. 2003; 327: 475-489Crossref PubMed Scopus (123) Google Scholar), the of were present and or as a result of N-terminal The tryptic to and including digest are from the the fragment to is and its sequence is by MS/MS analysis it that the N-terminal sequence is between and and this was confirmed by N-terminal sequencing to at to have from or from at by removal of the is a sequence of the for and with the of the for that the site for of the BpKatG in E. Mass spectrometry evidence for the adduct in the tryptic digests of BpKatG the from electron density ions consistent with three peptides linked by and two peptides linked by are evident in the spectrum of BpKatG in the spectrum of the W111F The covalent in the adduct are to breakdown mass spectrometry with the bond being more indirect evidence for its existence in the breakdown including CH3-S to Tyr238 and the existence of ions only in methionine or that the breakdown of the by more The of peptide that breakdown of the a breakdown that has been The tryptic digest of presents direct evidence for the linkage and indirect evidence for the The core structure of the N- and C-terminal domains of catalase-peroxidases is to the core structure of plant suggesting that the enzyme is a peroxidase that has an catalatic activity A of for this adaptation place are provided by the structure of the active The active site Trp111 is clearly for the generation of I + → I + which is by removal of the is for the second of I I + → + + which is to of native by removal of the However, the distal is the because peroxidases with in the as peroxidase and catalatic activity. Furthermore, the two active site in the and to and of BpKatG, are the as in BpKatG. Indeed, the of the of in including the three active site is BpKatG and peroxidase X. Lopraesert S. Mongkolsuk S. Switala J. Loewen P.C. Fita I. J. Mol. Biol. 2003; 327: 475-489Crossref PubMed Scopus (123) Google Scholar). The between the catalase-peroxidases and the from in the unusual in the the Trp-Tyr-Met and the heme, and it is to features the catalase reaction The linked form a structure that the of the of the essential to the heme and ring of the essential with possibility of to generate with the for the of I. Indeed, of Met264, which formation of at and all of the covalent reduces catalatic with on peroxidatic activity and of the of Tyr238 in KatG has a C. M. A. F. P.G. Obinger C. J. Biol. Chem. 2003; Full Text Full Text PDF PubMed Scopus Google Scholar). The covalent also the of the its to for I the adduct an for of the from the heme of a in M. tuberculosis KatG S. S. S. J. Biol. Chem. 2002; Full Text Full Text PDF PubMed Scopus Google Scholar). the of the peroxidatic reaction, electron from a peroxidatic substrate on the X. Lopraesert S. Mongkolsuk S. Switala J. Loewen P.C. Fita I. J. Mol. Biol. 2003; 327: 475-489Crossref PubMed Scopus (123) Google Scholar) to the heme for of I or also by the adduct. A of tryptic in the were present as of ions by This is of multiple the of a for this simple The spectrum of the cluster of ions at m/z 4525 are only three of oxidation in the Trp111, and for to two on and on the only ions Furthermore, the only site of oxidation that was in the electron density maps was the ring of Trp111 X. Lopraesert S. Mongkolsuk S. Switala J. Loewen P.C. Fita I. J. Mol. Biol. 2003; 327: 475-489Crossref PubMed Scopus (123) Google Scholar), and must at an to clearly This it likely that the more and the the CH3-S of Met264 to Tyr238. at two of ions are for the cluster at m/z is to the reaction for the Trp-Tyr-Met covalent and both and presented that by oxidation of the reactive However, analysis of variants the three and are to are and to a for The of G. and in of the mass in the of the of at the of is

Récupéré en direct depuis OpenAlex et désinversé. Les résumés ne sont pas conservés dans cette base de données : les index inversés représentent 8,6 Go des 9,3 Go de texte de la base, et le serveur dispose de 13 Go libres.

Comment cette classification a été obtenuedéplier

Prédiction distillée sur la base complète

Imitation des enseignants

Ni prévalence calibrée, ni vérité terrain. Validation humaine à venir. Apprise à partir de 10 348 étiquettes directes de Codex et de 10 348 étiquettes directes de Gemma. Le mode candidate est l'union des têtes enseignantes seuillées; le consensus est leur intersection. Ces sorties portent le statut machine_predicted_unvalidated et ne sont ni des étiquettes humaines ni des étiquettes directes de modèles de pointe.

score de la tête « metaresearch » (Codex)0,000
score de la tête « metaresearch » (Gemma)0,000
Version: codex-gemma-dda1882f352aStatut de validation: machine_predicted_unvalidated
Catégories candidatesCharge utile insuffisante (le modèle a refusé de juger)
Catégories consensuellesaucune
DomaineSignal candidat: aucune · Signal consensuel: aucune
Devis d'étudeSignal candidat: Expérimental (laboratoire) · Signal consensuel: Expérimental (laboratoire)
GenreSignal candidat: Empirique · Signal consensuel: Empirique
Score de désaccord entre enseignants0,063
Score d'incertitude au seuil1,000

Scores Codex et Gemma par catégorie

CatégorieCodexGemma
Métarecherche0,0000,000
Méta-épidémiologie (sens strict)0,0000,000
Méta-épidémiologie (sens large)0,0000,000
Bibliométrie0,0000,000
Études des sciences et des technologies0,0000,000
Communication savante0,0000,000
Science ouverte0,0000,000
Intégrité de la recherche0,0000,000
Charge utile insuffisante (le modèle a refusé de juger)0,0010,000

Scores machine (provisoires)

Les deux têtes enseignantes du modèle étudiant, lues sur ce travail. Un score ordonne la base pour la relecture; il n'affirme jamais une catégorie, et le statut de validation accompagne chaque rangée tel quel.

Scores de référence d'un modèle non mature (critères de maturité non atteints, 7 itérations). Un score ordonne; il n'affirme jamais une catégorie.

Tête enseignante Opus0,012
Tête enseignante GPT0,189
Écart entre enseignants0,177 · la distance entre les deux têtes enseignantes sur ce seul travail
Statut de validationscore_only:v0-immature-baseline · tel quel depuis la passe de notation : score_only signifie que le nombre peut ordonner les travaux, et qu'aucune étiquette de catégorie n'en découle

Classification

machine, non validée

Prédiction automatique; un appel candidat d’une seule tête enseignante, pas un consensus.

Devis d'étudeExpérimental (laboratoire)
Domainenon disponible
GenreEmpirique

Le détail, modèle par modèle et score par score, se trouve en fin de page sous « Comment cette classification a été obtenue ».

En bref

Citations55
Publié2003
Routes d'admission1
Résumé présentoui

Explorer davantage

Même revueJournal of Biological ChemistryMême sujetEnzyme-mediated dye degradationTravaux en français237 207