MétaCan
Menu
Retour à la cohorte
Enregistrement W2037270999 · doi:10.1074/jbc.m502262200

The ATM/p53/p21 Pathway Influences Cell Fate Decision between Apoptosis and Senescence in Reoxygenated Hematopoietic Progenitor Cells

2005· article· en· W2037270999 sur OpenAlexfundaboutno aff
Xiaoling Zhang, June Li, Daniel P. Sejas, Qishen Pang

Notice bibliographique

RevueJournal of Biological Chemistry · 2005
Typearticle
Langueen
DomaineMedicine
ThématiqueHematopoietic Stem Cell Transplantation
Établissements canadiensnon disponible
Organismes subventionnairesHospital for Sick ChildrenUniversity of Toronto
Mots-clésProgenitor cellBiologySenescenceHaematopoiesisCell biologyApoptosisBone marrowStem cellDNA damageMolecular biologyImmunologyBiochemistryDNA

Résumé

récupéré en direct d'OpenAlex

Hematopoietic cells are often exposed to transient hypoxia as they develop and migrate between blood and tissues. We tested the hypothesis that hypoxia-then-reoxygenation represent a stress for hematopoietic progenitor cells. Here we report that reoxygenation-generated oxidative stress induced senescence, tested as staining for SA-β-galactosidase (SA-β-gal), of bone marrow progenitor cells. Reoxygenation induced significant DNA damage and inhibited colony formation in lineage-depleted bone marrow cells enriched for progenitor cells. These reoxygenated cells exhibited a prolonged G0/G1 accumulation without significant apoptosis after 24 h of treatments. Reoxygenated bone marrow progenitor cells expressed SA-β-gal and senescence-associated proteins p53 and p21WAF1. Reoxygenated Fancc-/- progenitor cells, which underwent significant apoptosis and senescence, tested as staining for SA-β-gal, also expressed p16INK4A. Suppression of apoptosis by the pan-caspase inhibitor benzyloxycarbonyl-VAD-fluoromethyl ketone dramatically increased senescent Fancc-/- progenitor cells. Senescence induction, tested as staining for SA-β-gal, in reoxygenated progenitor cells was closely correlated with extent of DNA damage and phosphorylation of ATM at Ser-1981 and p53 at Ser-15. Moreover, inhibition of ATM signaling reduced SA-β-gal positivity but increased apoptosis of reoxygenated progenitor cells. Thus, these results suggest that the ATM/p53/p21 pathway influences cell fate decision between apoptosis and senescence in reoxygenated hematopoietic progenitor cells. Hematopoietic cells are often exposed to transient hypoxia as they develop and migrate between blood and tissues. We tested the hypothesis that hypoxia-then-reoxygenation represent a stress for hematopoietic progenitor cells. Here we report that reoxygenation-generated oxidative stress induced senescence, tested as staining for SA-β-galactosidase (SA-β-gal), of bone marrow progenitor cells. Reoxygenation induced significant DNA damage and inhibited colony formation in lineage-depleted bone marrow cells enriched for progenitor cells. These reoxygenated cells exhibited a prolonged G0/G1 accumulation without significant apoptosis after 24 h of treatments. Reoxygenated bone marrow progenitor cells expressed SA-β-gal and senescence-associated proteins p53 and p21WAF1. Reoxygenated Fancc-/- progenitor cells, which underwent significant apoptosis and senescence, tested as staining for SA-β-gal, also expressed p16INK4A. Suppression of apoptosis by the pan-caspase inhibitor benzyloxycarbonyl-VAD-fluoromethyl ketone dramatically increased senescent Fancc-/- progenitor cells. Senescence induction, tested as staining for SA-β-gal, in reoxygenated progenitor cells was closely correlated with extent of DNA damage and phosphorylation of ATM at Ser-1981 and p53 at Ser-15. Moreover, inhibition of ATM signaling reduced SA-β-gal positivity but increased apoptosis of reoxygenated progenitor cells. Thus, these results suggest that the ATM/p53/p21 pathway influences cell fate decision between apoptosis and senescence in reoxygenated hematopoietic progenitor cells. Hematopoietic cells are often exposed to transient hypoxia and reoxygenation as they develop and migrate between blood and tissues. Continuous cycles of hypoxia-then-reoxygenation has long been known to increase in the production of oxidants (1Kogure K. Watson B.D. Busto R. Abe K. Neurochem. Res. 1982; 7: 437-454Crossref PubMed Scopus (162) Google Scholar), which could cause DNA damage, protein oxidation, and lipid peroxidation (2Ames B.N. Shigenaga M.K. Hagen T.M. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 7915-7922Crossref PubMed Scopus (5511) Google Scholar, 3Stadtman E.R. Science. 1992; 257: 1220-1224Crossref PubMed Scopus (2417) Google Scholar). In human colorectal cell line RKO and lymphoblasts, hypoxia-then-reoxygenation induces DNA damage and activates p53, which can be inhibited by the anti-oxidant N-acetyl-l-cysteine (NAC) 1The abbreviations used are: NAC, N-acetyl-l-cysteine; 2-AP, 2-aminopurine; ATM, ataxia-telangiectasia mutated; siATM, small interfering ATM; HSC, hematopoietic stem cell; FA, Fanconi anemia; siRNA, small interfering RNA; β-gal, β-galactosidase; BM, bone marrow; Lin-, Lineage-negative; LSK, Lin- Sca-1+c-kit+; WT, wild type; Z, benzyloxycarbonyl; FMK, fluoromethyl ketone; FITC, fluorescein isothiocyanate; CFC, colony-forming cell; PE, phycoerythrin; APC, allophycocyanin. (4Hammond E.M. Dorie M.J. Giaccia A.J. J. Biol. Chem. 2003; 278: 12207-12213Abstract Full Text Full Text PDF PubMed Scopus (247) Google Scholar). Furthermore, reoxygenation-induced DNA damage and p53 activation is dependent on the protein kinase ATM (ataxia-telangiectasia mutated; Refs. 4Hammond E.M. Dorie M.J. Giaccia A.J. J. Biol. Chem. 2003; 278: 12207-12213Abstract Full Text Full Text PDF PubMed Scopus (247) Google Scholar and 5Hammond E.M. Giaccia A.J. DNA Repair (Amst.). 2004; 3: 1117-1122Crossref PubMed Scopus (70) Google Scholar). Oxidative stress-induced DNA damage is well known to cause loss of cell replication and multiple molecular changes involved in premature senescence, such as up-regulation of senescence-associated proteins p53, p21WAF1, and p16INK4A and permanent growth arrest (6Chen Q.M. Ann. N. Y. Acad. Sci. 2000; 908: 111-125Crossref PubMed Scopus (147) Google Scholar). Little is known about the effects of reoxygenation-generated oxidative stress on the survival and maintenance hematopoietic progenitor and stem (HSC) cells. Studies on pathophysiological mechanisms of oxidative stress responses in stem cell diseases such as aplastic anemia has been very instructive and provides insights into the function of normal hematopoietic stem cells and their self-renewal capacity (7Maciejewski J.P. Risitano A. Arch. Med. Res. 2003; 34: 520-527Crossref PubMed Scopus (36) Google Scholar). One of the well studied AA disease models is Fanconi anemia (FA), a genetic disorder characterized by progressive bone marrow failure and a predisposition to cancer (8Bagby Jr., G.C. Curr. Opin. Hematol. 2003; 10: 68-76Crossref PubMed Scopus (144) Google Scholar, 9D'Andrea A.D. Grompe M. Nat. Rev. Cancer. 2003; 3: 23-34Crossref PubMed Scopus (681) Google Scholar). We hypothesized that hypoxia-reoxygenation represents a physiological stress for HSC and progenitor cells, particularly those from FA patients, and sought to determine the molecular response of hematopoietic progenitor cells to reoxygenation-generated oxidative stress. Our study demonstrates that oxidative stress generated by reoxygenation can induce premature senescence, tested as staining for SA-β-galactosidase (SA-β-gal), of Fancc-/- hematopoietic progenitor cells through the ATM/p53/p21 pathway and suggests that stress-induced senescence may be a novel mechanism underlying hematopoietic cell depletion in bone marrow (BM) failure diseases including FA. Mice, Isolation of BM Lin- Sca-1+c-kit+ (LSK) Cells, and Treatments—WT and Fancc-/- mice were generated by interbreeding the heterozygous Fancc+/- mice (a gift from Dr. Manuel Buchwald, University of Toronto; Ref. 10Chen M. Tomkins D. Auerbach W. McKerlie C. Youssoufian H. Liu L. Gan O. Carreau M. Auerbach A. Groves T. Guidos C. Freedman M. Cross J. Percy D. Dick J. Joyner A. Buchwald M. Nat. Genet. 1996; 12: 448-451Crossref PubMed Scopus (221) Google Scholar). Lineage-negative (Lin-) cells were isolated using a lineage cell depletion kit (Miltenyi Biotec Inc.) in accordance with manufacturer's instruction. BM Lin- cells were then stained with Sca-1-PE and c-kit-APC antibodies followed by cell sorting using a FACSCalibur (BD Biosciences). The resulting LSK cells were cultured in Iscove's modified Dulbecco's medium containing stem cell factor (100 ng/ml), interleukin-6 (20 ng/ml), and Flt-3L (50 ng/ml) (R&D Systems). Three sets of cells were incubated in parallel: 1) the control cultures were incubated at 37 °C in normoxia (humidified air with 21% O2, 5% CO2); 2) the reoxygenated cultures were subjected to hypoxia (1% O2) for 4 h then shifted to 21% O2; 3) the reoxygenated-NAC cultures were the same as those in set 2 except that the medium contained the anti-oxidant NAC at a concentration of 1 mm. Pan-caspase inhibitor Z-VAD-FMK (Calbiochem) was added to cell cultures immediately after reoxygenation at 100 μm. For 2-aminopurine (2-AP) treatment, cells were incubated with 10 mm 2-AP (Sigma) during hypoxia-reoxygenation treatments. Apoptosis Assay—Aliquots of 1 × 105 BM Lin- cells were stained with Sca-1-PE and c-kit-APC antibodies followed by annexin V staining. These experiments also included PE and APC isotype controls, and FITC positive and negative controls. Apoptosis was therefore analyzed in different populations of Lin- cells by flow cytometry. Clonogenic Progenitor Cell Assays and BM Transplantation—BM LSK cells were subjected to hypoxia-reoxygenation with or without 2-AP and cultured in a 35-mm tissue culture dish in 4 ml of semisolid medium containing 3 ml of MethoCult M 3134 (Stem Cell Technologies) and the following growth factors: 100 ng/ml stem cell factor, 10 ng/ml interleukin-3, 100 ng/ml granulocyte-colony-stimulating factor, and 4 units/ml erythropoietin. Colonies (colony-forming cells (CFCs)) were counted on day 7. To evaluate the effect of reoxygenation on the repopulation ability of the BM progenitor cells, we used a NOD/SCID repopulation assay. NOD/SCID mice (Jackson Laboratories) were handled under sterile conditions and maintained under microisolaters. WT or Fancc-/- BM (2 × 106) cells were transplanted by tail vein injection into sublethal irradiated (3.5 Gy) 8-week-old mice along with 5 × 105 competitor cells. BM cells from the transplanted mice were stained with H2kb-PE (for donor-derived cells) and H2kd-FITC (for recipient-derived cells) antibodies (Pharmingen) and analyzed by flow cytometry to detect donor-derived hematopoietic progenitors. SiRNA and Assays for DNA Damage and Senescence—The siRNA oligonucleotides targeting nucleotides 8111-8131 of mouse ATM mRNA (GeneBank™ sequence accession number NM007499; GGTGACTATAAAATCATTTAA) were cloned in the pSM2c retroviral vector (Open Biosystems). Infected cells were selected for puromycin resistance. The generation of DNA strand breaks in control and reoxygenated BM LSK cells was assessed by the single cell gel electrophoresis (comet) assay (11Tice R.R. Agurell E. Anderson D. Burlinson B. Hartmann A. Kobayashi H. Miyamae Y. Rojas E. Ryu J.C. Sasaki Y.F. Environ. Mol. Mutagen. 2000; 35: 206-221Crossref PubMed Scopus (4141) Google Scholar), using a Fpg-FLARE (fragment length analysis using repair enzymes) comet assay kit in accordance with the manufacturer's instructions (Trevigen). SA-β-gal activity was determined using a SA-β-gal staining kit (Cell Signaling Technology) according to the manufacturer's instruction. Immunocytochemistry—BM LSK cells were stained with primary antibodies (monoclonal anti-ATMSer-1981, Rockland Immunochemistry Research; monoclonal anti-p53Ser-15 and polyclonal anti-p21WAF1, Cell Signaling; monoclonal anti-p16, Santa Cruz Biotechnologies) and then with Rhodamine Red-X-conjugated goat anti-rabbit IgG or Rhodamine Red-X-conjugated goat anti-mouse IgG (Jackson ImmunoResearch). Nuclei were counter-stained with 4′,6-diamidino-2-phenylindole (Sigma). Statistics—Data were analyzed statistically using a Student's t test. The level of statistical significance stated in the text was based on the p values. p < 0.05 was considered statistically significant. Reoxygenation-generated Oxidative Stress Induces DNA Damage and Inhibits Colony Formation in BM Progenitor Cells—Because reoxygenation represents oxidative stress to the cell and oxidative stress induces DNA damage (2Ames B.N. Shigenaga M.K. Hagen T.M. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 7915-7922Crossref PubMed Scopus (5511) Google Scholar, 4Hammond E.M. Dorie M.J. Giaccia A.J. J. Biol. Chem. 2003; 278: 12207-12213Abstract Full Text Full Text PDF PubMed Scopus (247) Google Scholar, 6Chen Q.M. Ann. N. Y. Acad. Sci. 2000; 908: 111-125Crossref PubMed Scopus (147) Google Scholar), we first sought to determine whether hypoxia-then-reoxygenation caused DNA damage in BM progenitor cells. Analysis of DNA strand breaks by comet assay revealed that there was increased accumulation of DNA damage in reoxygenated Lin- Sca-1+c-kit+ (KSL) BM cells compared with untreated counterparts (Fig. 1A). The Fancc-deficient mice have a profound defect in the hematopoietic stem and progenitor cell compartment, and FA HSCs and progenitors have been shown to be hypersensitive to a variety of stresses including oxidative stress (8Bagby Jr., G.C. Curr. Opin. Hematol. 2003; 10: 68-76Crossref PubMed Scopus (144) Google Scholar, 12Tischkowitz M. Dokal I. Br. J. Haematol. 2004; 126: 176-191Crossref PubMed Scopus (119) Google Scholar, 13Saadatzadeh M.R. Bijangi-Vishehsaraei K. Hong P. Bergmann H. Haneline L.S. J. Biol. Chem. 2004; 279: 16805-16812Abstract Full Text Full Text PDF PubMed Scopus (64) Google Scholar). Consistent with these observations, reoxygenated Fancc-/- KSL cells induced significant (3.8-fold) more DNA strand breakage than reoxygenated WT KSL cells (Fig. 1A). Treatment of reoxygenated WT or Fancc-/- KSL cells with the anti-oxidant NAC completely abrogated the effect (Fig. 1A), suggesting that the DNA damage was generated by oxidative stress. The number of CFCs derived from both reoxygenated WT and Fancc-/- BM progenitors was significantly decreased compared with their untreated counterparts, and NAC completely restored the progenitor activity of these reoxygenated KSL cells (Fig. 1B). Reoxygenated BM Progenitor Cells Undergo Growth Arrest and Have Reduced BM Repopulating Ability—While reoxygenation induced more apoptosis in Fancc-/- BM KSL cells than in WT KSL cells shortly after exposure to high oxygen, apoptotic cells decreased thereafter (Fig. 1C). In addition, the extent of the increase was not as significant as reoxygenation-generated DNA damage at 24 h post-reoxygenation (compare Fig. 1A). Actually, apoptosis decreased to basal level 48 h post-reoxygenation (Fig. 1C). Thus, apoptosis is not the major consequence of the DNA damage. We therefore evaluated the cell cycle profile of these BM cells. Reoxygenated BM cells clearly exhibited a prolonged G0 + G1 accumulation (Fig. 1D), suggesting that there might exist an overactivated G0/G1 checkpoint in these BM progenitor cells. The marrow repopulating ability of reoxygenated progenitors was assessed by transplanting equal numbers of either untreated (control) or reoxygenated progenitors into sublethally irradiated NOD/SCID recipients. Engraftment was evaluated 4 weeks after transplantation by flow cytometric determination of donor-derived cells (H2kb+) in BM cell suspensions of the bone marrow harvested from recipient animals. The bone marrow of animals that received transplants of reoxygenated WT or Fancc-/- cells showed 2- or 3-fold lower engraftment than the untreated counterparts, respectively (Fig. 1E). Consistent with the observations of others (10Chen M. Tomkins D. Auerbach W. McKerlie C. Youssoufian H. Liu L. Gan O. Carreau M. Auerbach A. Groves T. Guidos C. Freedman M. Cross J. Percy D. Dick J. Joyner A. Buchwald M. Nat. Genet. 1996; 12: 448-451Crossref PubMed Scopus (221) Google Scholar), Fancc deficiency impairs the repopulating ability of Fancc-/- BM progenitors. Cell Fate Choice between Senescence, Tested as Staining for SA-β-gal, and Apoptosis in Reoxygenated BM Progenitor Cells—Because reoxygenated BM progenitor cells underwent G0/G1 arrest, we reasoned that stress-induced senescence might be one fate of these cells. To examine this possibility, we stained WT and Fancc-/- BM KSL cells for SA-β-galactosidase, a biomarker for senescence (14Dimri G.P. Lee X. Basile G. Acosta M. Scott G. Roskelley C. Medrano E.E. Linskens M. Rubelj I. Pereira-Smith O.A. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 9363-9367Crossref PubMed Scopus (5929) Google Scholar). Nearly 20% of the reoxygenated WT KSL cells and more than 40% of the reoxygenated Fancc-/- KSL cells stained positive for SA-β-galactosidase activity after 48 h of reoxygenation (Fig. 2A). Because we observed reoxygenation-induced apoptosis, especially in Fancc-/- BM progenitor cells, we asked whether blockage of apoptosis would increase senescence, tested as staining for SA-β-gal, in these reoxygenated BM cells. Indeed, when these reoxygenated BM KSL cells were incubated in the presence of the pan-caspase inhibitor Z-VAD-FMK, more than 60% of the Fancc-/- cells entered senescence, tested as staining for SA-β-gal, compared with ∼ 40% without the apoptotic inhibitor (Fig. 2B). Therefore, reoxygenated Fancc-/- BM progenitor cells blocked for apoptosis may be prone to developing senescence. Reoxygenation-induced Senescence, Tested as Staining for SA-β-gal, in BM Progenitor Cells Involves the ATM/p53/p21WAF1 Pathway—Because reoxygenation induces DNA damage and subsequent p53 activation, which is dependent on the ATM kinase (4Hammond E.M. Dorie M.J. Giaccia A.J. J. Biol. Chem. 2003; 278: 12207-12213Abstract Full Text Full Text PDF PubMed Scopus (247) Google Scholar, 5Hammond E.M. Giaccia A.J. DNA Repair (Amst.). 2004; 3: 1117-1122Crossref PubMed Scopus (70) Google Scholar), we asked whether reoxygenation-induced senescence, tested as staining for SA-β-gal, in BM progenitor cells involves the ATM/p53/p21WAF1 pathway. We examined the reoxygenation-induced phosphorylation of ATM (Ser-1981) and p53 (Ser-15) and expression of p21 in BM KSL cells. ATM autophosphorylation at Ser-1981 activates the kinase and is largely responsible for phosphorylating p53 at Ser-15 in response to DNA damage (15Bakkenist C.J. Kastan M.B. Nature. 2003; 421: 499-506Crossref PubMed Scopus (2749) Google Scholar, 16Kurz E.U. Lees-Miller S.P. DNA Repair (Amst.). 2004; 3: 889-900Crossref PubMed Scopus (402) Google Scholar). We found ∼20% each of ATMSer-1981- and p53Ser-15-positive (Fig. and in reoxygenated WT BM KSL cells. In reoxygenated Fancc-/- BM KSL cells, the and of cells stained positive for and increased significantly (Fig. and We also found that of stained cells were in reoxygenated WT BM KSL cells compared with untreated WT cells. The of cells increased to in those FA BM KSL cells (Fig. and To that there is a between activation of the ATM/p53/p21 pathway and senescence, we to whether blockage of ATM signaling inhibited reoxygenation-induced senescence, tested as staining for SA-β-gal, in BM progenitor cells. is known that inhibition of ATM can senescent cell cycle arrest L. H. P. T. G. S.P. Nature. 2003; PubMed Scopus Google Scholar). We used both siRNA and the kinase inhibitor 2-AP, which has been shown to ATM activation S. R. Y. 2003; PubMed Scopus Google Scholar, U. Mol. 2004; Full Text Full Text PDF PubMed Scopus Google Scholar). BM KSL cells the ATM siRNA or with 2-AP reduced and in reoxygenated WT and Fancc-/- BM KSL cells (Fig. and We then determined progenitor activity of these reoxygenated BM KSL cells in a assay (Fig. Our was that inhibition of ATM senescence, tested as staining for SA-β-gal, then the cells would be to as by the progenitor reoxygenated WT BM KSL cells ATM siRNA or with 2-AP exhibited increased ability restored colony formation to the level of untreated WT BM KSL Fig. both and 2-AP on progenitor activity of the reoxygenated Fancc-/- BM KSL cells (Fig. that the ability of the cell to senescent cell cycle arrest or senescence on the of p16INK4A expression U. Mol. 2004; Full Text Full Text PDF PubMed Scopus Google Scholar, A. M. P. J. J. 2003; PubMed Scopus Google Scholar). Our observations that inhibition of ATM signaling increased ability (Fig. of WT but not Fancc-/- progenitor cells to examine the between p16INK4A expression and senescence, tested as staining for Reoxygenation induced p16INK4A expression in WT BM KSL cells but in Fancc-/- BM KSL cells (Fig. of or 2-AP reduced expression in reoxygenated WT cells but not have effect on Fancc-/- BM KSL cells (Fig. that reoxygenation-induced p16INK4A expression in Fancc-/- BM KSL cells was of ATM when we correlated ATM inhibition and p16INK4A expression with SA-β-gal we found that reoxygenated WT BM KSL cells with 2-AP and were of cells from to and Fig. In inhibition of ATM activity not significantly reduced SA-β-gal staining in reoxygenated Fancc-/- BM KSL cells, which expressed high of p16INK4A (Fig. inhibition of ATM activity increased apoptosis in reoxygenated WT and Fancc-/- BM KSL cells (Fig. These results that inhibition of ATM can senescence, tested as staining for SA-β-gal, of BM progenitor cells that not or level of and suggest that the ATM/p53/p21 pathway influences cell fate decision between apoptosis and senescence in reoxygenated hematopoietic progenitor cells. In we have shown that 1) reoxygenation-generated oxidative stress induced DNA damage and G0/G1 arrest in BM progenitor cells without significant 2) reoxygenation induced senescence, tested as staining for SA-β-gal, in reoxygenated BM progenitor 3) of senescence, tested as staining for SA-β-gal, in reoxygenated BM progenitor cells closely correlated with the extent of DNA damage and phosphorylation of ATM at Ser-1981 and p53 at and inhibition of ATM signaling reoxygenation-induced senescence, tested as staining for SA-β-gal, but increased apoptosis in BM progenitor cells. Thus, these results suggest that reoxygenation induces senescence in hematopoietic progenitor cells through the ATM/p53/p21 pathway. These are especially to the survival and maintenance of hematopoietic progenitor cells that are often exposed to transient hypoxia in and hematopoietic cell depletion is the major cause of BM failure in aplastic anemia including FA, to the molecular of BM We that the ATM kinase a major in the reoxygenation-induced DNA damage in BM progenitor cells. Reoxygenation can oxidative which can damage is known that ATM the of DNA damage induced by oxidative stress. For the accumulation of resulting in DNA damage and apoptosis by a pathway H. D. Science. PubMed Scopus Google Scholar, H. I. S. Y. T. C. T. Y. Mol. Full Text Full Text PDF PubMed Scopus Google Scholar, O. M. S. M. Mol. Full Text Full Text PDF PubMed Scopus Google Scholar). ATM has been shown to an in DNA damage generated by through phosphorylation of (4Hammond E.M. Dorie M.J. Giaccia A.J. J. Biol. Chem. 2003; 278: 12207-12213Abstract Full Text Full Text PDF PubMed Scopus (247) Google Scholar, 5Hammond E.M. Giaccia A.J. DNA Repair (Amst.). 2004; 3: 1117-1122Crossref PubMed Scopus (70) Google Scholar). We used siRNA targeting ATM and the protein kinase inhibitor 2-AP to the of ATM in DNA damage response of reoxygenated BM progenitor cells. of ATM signaling in of and p21 expression and of senescence, tested as staining for SA-β-gal, in reoxygenated BM progenitor cells but these BM cells to apoptosis (Fig. Our results for the first that senescence, tested as staining for SA-β-gal, in reoxygenated BM progenitor cells is by the ATM/p53/p21 pathway. We the of mechanisms for WT and Fancc-/- BM cells with to cell cycle arrest in response to DNA damage induced by reoxygenation-generated oxidative stress. DNA damage, WT BM cells arrest cell cycle by activation of the G1 checkpoint to for DNA The major pathway responsible for the G1 checkpoint involves the activation of p53 by ATM, the of and a in the level of the DNA damage be in a the cells senescence to accumulation of genetic the damage has been In Fancc-/- BM progenitor cells, DNA damage of the ATM resulting in a G1 The Fancc-/- BM cells senescence, the DNA damage of ATM in these FA cells results in of G1 checkpoint and We Dr. Manuel Buchwald for University of for the Fancc+/- P. Dr. for

Récupéré en direct depuis OpenAlex et désinversé. Les résumés ne sont pas conservés dans cette base de données : les index inversés représentent 8,6 Go des 9,3 Go de texte de la base, et le serveur dispose de 13 Go libres.

Comment cette classification a été obtenuedéplier

Prédiction distillée sur la base complète

Imitation des enseignants

Ni prévalence calibrée, ni vérité terrain. Validation humaine à venir. Apprise à partir de 10 348 étiquettes directes de Codex et de 10 348 étiquettes directes de Gemma. Le mode candidate est l'union des têtes enseignantes seuillées; le consensus est leur intersection. Ces sorties portent le statut machine_predicted_unvalidated et ne sont ni des étiquettes humaines ni des étiquettes directes de modèles de pointe.

score de la tête « metaresearch » (Codex)0,001
score de la tête « metaresearch » (Gemma)0,000
Version: codex-gemma-dda1882f352aStatut de validation: machine_predicted_unvalidated
Catégories candidatesaucune
Catégories consensuellesaucune
DomaineSignal candidat: aucune · Signal consensuel: aucune
Devis d'étudeSignal candidat: Expérimental (laboratoire) · Signal consensuel: Expérimental (laboratoire)
GenreSignal candidat: Empirique · Signal consensuel: Empirique
Score de désaccord entre enseignants0,035
Score d'incertitude au seuil0,396

Scores Codex et Gemma par catégorie

CatégorieCodexGemma
Métarecherche0,0010,000
Méta-épidémiologie (sens strict)0,0000,000
Méta-épidémiologie (sens large)0,0000,000
Bibliométrie0,0000,000
Études des sciences et des technologies0,0000,000
Communication savante0,0000,000
Science ouverte0,0000,000
Intégrité de la recherche0,0000,000
Charge utile insuffisante (le modèle a refusé de juger)0,0000,000

Scores machine (provisoires)

Les deux têtes enseignantes du modèle étudiant, lues sur ce travail. Un score ordonne la base pour la relecture; il n'affirme jamais une catégorie, et le statut de validation accompagne chaque rangée tel quel.

Scores de référence d'un modèle non mature (critères de maturité non atteints, 7 itérations). Un score ordonne; il n'affirme jamais une catégorie.

Tête enseignante Opus0,020
Tête enseignante GPT0,266
Écart entre enseignants0,245 · la distance entre les deux têtes enseignantes sur ce seul travail
Statut de validationscore_only:v0-immature-baseline · tel quel depuis la passe de notation : score_only signifie que le nombre peut ordonner les travaux, et qu'aucune étiquette de catégorie n'en découle

Classification

machine, non validée

Prédiction automatique; un appel candidat d’une seule tête enseignante, pas un consensus.

Les modèles n’ont appliqué aucune catégorie : rien dans la taxonomie ne correspondait à ce travail.
Devis d'étudeExpérimental (laboratoire)
Domainenon disponible
GenreEmpirique

Le détail, modèle par modèle et score par score, se trouve en fin de page sous « Comment cette classification a été obtenue ».

En bref

Citations71
Publié2005
Routes d'admission2
Résumé présentoui

Explorer davantage

Même revueJournal of Biological ChemistryMême sujetHematopoietic Stem Cell TransplantationTravaux en français237 207