Identification of a Novel Na+/myo-Inositol Cotransporter

rkST1, an orphan cDNA of the SLC5 family (43% identical in sequence to the sodium myo-inositol cotransporter SMIT), was expressed in Xenopus laevis oocytes that were subsequently voltage-clamped and exposed to likely substrates. Whereas superfusion with glucose and other sugars produced a small inward current, the largest current was observed with myo-inositol. The expressed protein, which we have named SMIT2, cotransports myo-inositol with aK m of 120 μm and displays a current-voltage relationship similar to that seen with SMIT (now called SMIT1). The transport is Na+-dependent, with aK m of 13 mm. SMIT2 exhibits phlorizin-inhibitable presteady-state currents and substrate-independent “Na+ leak” currents similar to those of related cotransporters. The steady-state cotransport current is also phlorizin-inhibitable with a K i of 76 μm. SMIT2 exhibits stereospecific cotransport of bothd-glucose and d-xylose but does not transport fucose. In addition, SMIT2 (but not SMIT1) transportsd-chiro-inositol. Based on previous publications, the tissue distribution of SMIT2 is different from that of SMIT1, and the existence of this second cotransporter may explain much of the heterogeneity that has been reported for inositol transport. rkST1, an orphan cDNA of the SLC5 family (43% identical in sequence to the sodium myo-inositol cotransporter SMIT), was expressed in Xenopus laevis oocytes that were subsequently voltage-clamped and exposed to likely substrates. Whereas superfusion with glucose and other sugars produced a small inward current, the largest current was observed with myo-inositol. The expressed protein, which we have named SMIT2, cotransports myo-inositol with aK m of 120 μm and displays a current-voltage relationship similar to that seen with SMIT (now called SMIT1). The transport is Na+-dependent, with aK m of 13 mm. SMIT2 exhibits phlorizin-inhibitable presteady-state currents and substrate-independent “Na+ leak” currents similar to those of related cotransporters. The steady-state cotransport current is also phlorizin-inhibitable with a K i of 76 μm. SMIT2 exhibits stereospecific cotransport of bothd-glucose and d-xylose but does not transport fucose. In addition, SMIT2 (but not SMIT1) transportsd-chiro-inositol. Based on previous publications, the tissue distribution of SMIT2 is different from that of SMIT1, and the existence of this second cotransporter may explain much of the heterogeneity that has been reported for inositol transport. The first members of the vertebrate cotransporter protein family SLC5, which includes the high affinity Na+/glucose cotransporter (SGLT1) and the Na+/myo-inositol cotransporter (SMIT), were isolated over a decade ago based on expression of the proteins in Xenopus laevisoocytes (1Hediger M.A. Coady M.J. Ikeda T.S. Wright E.M. Nature. 1987; 330: 379-381Crossref PubMed Scopus (813) Google Scholar, 2Kwon H.M. Yamauchi A. Uchida S. Preston A.S. Garcia-Perez A. Burg M.B. Handler J.S. J. Biol. Chem. 1992; 267: 6297-6301Abstract Full Text PDF PubMed Google Scholar). Although substrates as diverse as proline, iodide, and vitamins (3Wright E.M. Am. J. Physiol. 2001; 280: F10-F18Crossref PubMed Google Scholar) are transported by this family of proteins, the best characterized transporters remain SGLT1 and SMIT. There are also several “orphan” transporters whose cDNA has been cloned either by using labeled cDNA from members of the SLC5 family as biochemical probes or by comparing SLC5 sequence information in silico to data stored in DNA data bases (3Wright E.M. Am. J. Physiol. 2001; 280: F10-F18Crossref PubMed Google Scholar); the newly discovered sequences are orphans in that they have no known function. Some of the orphan protein sequences are particularly similar to the protein sequences for SGLT1 and SMIT (4Hitomi K. Tsukagoshi N. Biochim. Biophys. Acta. 1994; 1190: 469-472Crossref PubMed Scopus (23) Google Scholar, 5Pajor A.M. Biochim. Biophys. Acta. 1994; 1194: 349-351Crossref PubMed Scopus (6) Google Scholar) and presumably transport substrates similar or identical to either glucose or its isomermyo-inositol. The SLC5 proteins with known functions have generally been studied by voltage-clamp experiments because these proteins are electrogenic. Also, presteady-state currents are associated with expression of these proteins at the cell surface, and some (but not all, e.g. xSGLT1L (6Nagata K. Hori N. Sato K. Ohta K. Tanaka H. Hiji Y. Am. J. Physiol. 1999; 276: G1251-G1259PubMed Google Scholar)) SLC5 proteins also exhibit a substrate-independent Na+ current (“Na+ leak”). myo-Inositol (MI) 1The abbreviations used are: MI, myo-inositol; I-V, current-voltage. is the most biologically abundant stereoisomer of the inositols, cyclic polyols which serve as precursors to molecules involved in several important aspects of cell physiology, including cell signaling via the inositol phosphate pathways (7Downes C.P. Macphee C.H. Eur. J. Biochem. 1990; 193: 1-18Crossref PubMed Scopus (179) Google Scholar) and the production of phospholipids involved in cell adhesion and vesicular trafficking (8Toker A. Cantley L.C. Nature. 1997; 387: 673-676Crossref PubMed Scopus (1229) Google Scholar). MI also serves as a “compatible osmolyte” used to control intracellular osmolarity in various tissues, including kidney, brain, and endothelium (9Nakanishi T. Balaban R.S. Burg M.B. Am. J. Physiol. 1988; 255: C181-C191Crossref PubMed Google Scholar, 10Wiese T.J. Dunlap J.A. Conner C.E. Grzybowski J.A. Lowe W.L. Yorek M.A. Am. J. Physiol. 1996; 270: C990-C997Crossref PubMed Google Scholar, 11Trachtman H. Pediatr. Nephrol. 1992; 6: 104-112Crossref PubMed Scopus (68) Google Scholar). Although mammalian serum levels of MI are normally between 30 and 70 μm (12Ashizawa N. Yoshida M. Aotsuka T. J. Biochem. Biophys. Methods. 2000; 44: 89-94Crossref PubMed Scopus (32) Google Scholar, 13MacGregor L.C. Matschinsky F.M. Anal. Biochem. 1984; 141: 382-389Crossref PubMed Scopus (56) Google Scholar, 14Dolhofer R. Wieland O.H. J. Clin. Chem. Clin. Biochem. 1987; 25: 733-736PubMed Google Scholar), the MI levels within mammalian cells can attain 30 mm (15Schmolke M. Bornemann A. Guder W.G. Biol. Chem. Hoppe-Seyler. 1990; 371: 909-916Crossref PubMed Scopus (27) Google Scholar). There appear to be several transport mechanisms involved in the active uptake of MI into various types of cells (16Nakanishi T. Turner R.J. Burg M.B. Proc. Natl. Acad. Sci. U. S. A. 1989; 86: 6002-6006Crossref PubMed Scopus (103) Google Scholar, 17Novak J.E. Turner R.S. Agranoff B.W. Fisher S.K. J. Neurochem. 1999; 72: 1431-1440Crossref PubMed Scopus (46) Google Scholar, 18Ostlund Jr., R.E. Seemayer R. Gupta S. Kimmel R. Ostlund E.L. Sherman W.R. J. Biol. Chem. 1996; 271: 10073-10078Abstract Full Text Full Text PDF PubMed Scopus (40) Google Scholar, 19Cammarata P.R. Chen H.Q. Yang J. Yorio T. Invest. Ophthalmol. Vis. Sci. 1992; 33: 3572-3580PubMed Google Scholar), and examples of tissues seeming to lack active transport of MI have also been described (20Sigal S.H. Yandrasitz J.R. Berry G.T. Metabolism. 1993; 42: 395-401Abstract Full Text PDF PubMed Scopus (17) Google Scholar, 21Noh S.J. Kim M.J. Shim S. Han J.K. J. Cell. Physiol. 1998; 176: 412-423Crossref PubMed Scopus (34) Google Scholar, 22Warfield A. Hwang S.M. Segal S. J. Neurochem. 1978; 31: 957-960Crossref PubMed Scopus (22) Google Scholar). In particular, one transporter that exhibits similar affinities for MI and for its epimer d-chiro-inositol has been demonstrated in the hepatic cell culture line HepG2 (18Ostlund Jr., R.E. Seemayer R. Gupta S. Kimmel R. Ostlund E.L. Sherman W.R. J. Biol. Chem. 1996; 271: 10073-10078Abstract Full Text Full Text PDF PubMed Scopus (40) Google Scholar); in contrast, transport of d-chiro-inositol is not observed with the SMIT transporter (18Ostlund Jr., R.E. Seemayer R. Gupta S. Kimmel R. Ostlund E.L. Sherman W.R. J. Biol. Chem. 1996; 271: 10073-10078Abstract Full Text Full Text PDF PubMed Scopus (40) Google Scholar). The proteins known to transport MI in mammals are SMIT and HMIT, a H+/MI cotransporter from a completely different protein family (23Uldry M. Ibberson M. Horisberger J.D. Chatton J.Y. Riederer B.M. Thorens B. EMBO J. 2001; 20: 4467-4477Crossref PubMed Scopus (186) Google Scholar). In this work, we have found that a novel Na+/MI cotransport activity is associated with expression of one of the orphan proteins of the SLC5 family (rkST1) (4Hitomi K. Tsukagoshi N. Biochim. Biophys. Acta. 1994; 1190: 469-472Crossref PubMed Scopus (23) Google Scholar) in Xenopus oocytes. The substrate specificities and transport kinetics of this protein exhibit both functional similarities to the previously cloned SMIT transporter as well as obvious differences, including the transport ofd-chiro-inositol. The existence of this second cotransporter may explain some of the heterogeneity that has been reported for Na+/MI uptake. Unless otherwise noted, all of the chemicals were purchased from Sigma-Aldrich. d-glucose,d-xylose, and l-xylose were analyzed by high pressure liquid chromatography (courtesy of Douglas Heimark, Insmed Inc., Glen Allen, VA); none of the three sugars contained detectable levels of MI (>0.1%). d-chiro-Inositol andl-chiro-inositol were from Industrial Research Ltd. (Lower Hutt, New Zealand). Phlorizin was diluted at least 1:1000 from a 500 mm solution in ethanol. For studies where the concentration of phlorizin was varied, phlorizin crystals were dissolved directly into the saline solution. The coding region of the rabbit cDNA rkST1 (4Hitomi K. Tsukagoshi N. Biochim. Biophys. Acta. 1994; 1190: 469-472Crossref PubMed Scopus (23) Google Scholar) was obtained by PCR on renal cDNA using the phosphorylated oligonucleotides GATCTCACCATGGAGAGCAGCACCAGCA and CTAGTCTAGGCGAAGTAGCCCCAGAGGAA (AlphaDNA, Montreal, Canada) and Pfu DNA polymerase (Stratagene, San Diego, CA). The ends of the PCR product were digested with Exonuclease III to yield 5′ overhangs (24Kaluz S. Kolble K. Reid K.B. Nucleic Acids Res. 1992; 20: 4369-4370Crossref PubMed Scopus (32) Google Scholar). Following this, the DNA product was ligated between theBglII and SpeI sites of pT7T3, a vector designed for strong expression of transcripts in oocytes (kindly provided by Dr. Paul Krieg, University of Texas at Austin). Following purification of the recombinant plasmid, an aliquot of the DNA was cleaved by digestion with EcoRI, followed by in vitro transcription using T7 RNA polymerase (25Pokrovskaya I.D. Gurevich V.V. Anal. Biochem. 1994; 220: 420-423Crossref PubMed Scopus (91) Google Scholar). The identity of the cloned PCR product was confirmed by dideoxy sequencing. There were 8 base pairs that differed from the published rabbit rsKT1 cDNA sequence, resulting in one conservative alteration in the protein sequence (T173A)*. The oocytes were removed from gravid female X. laevis frogs (Connecticut Valley Biological Supply Co., Southampton, MA) under tricaine anesthesia. The individually dissected oocytes were placed into a Ca2+-free buffered saline solution (200 millosmolar) and defolliculated by collagenase digestion. The oocytes were maintained at 18 °C in Barth's solution (90 mm NaCl, 3 mm KCl, 0.82 mm MgSO4, 0.41 mmCaCl2, 0.33 mmCa(NO3)2, 5 mm HEPES, pH 7.6) supplemented with 5% horse serum J. N. 1992; Google Scholar) where mm sodium and RNA otherwise was into the oocytes the oocytes were for transporter activity at the The currents were with a as described previously M.J. Chen X. A. J.Y. 1994; PubMed Scopus Google Scholar). In a and a data were used to to the as well as to current and The was with a saline solution mm NaCl, 3 mm KCl, 0.82 mm mm mm pH a of was whose was were The was at which a from to was in The was to the levels for and were analyzed by the in a of the of The are generally in the and in the of a and the current is by of one current from the the concentration of was was of the steady-state and presteady-state current experiments were at For the of presteady-state the was to and the was to The was from to in from a of The currents in the of mm phlorizin were by from the currents in a saline solution 30 The was obtained by the of the presteady-state and the m was to the where are the at and is the of the is the m at which of the is and are the was using the of rkST1 in Xenopus oocytes was by a of the protein on the of of rkST1 at a concentration of or in the of all oocytes by the either or by in Barth's of of the oocytes to The was by of 5% horse serum in the J. N. 1992; Google Scholar), which in of all oocytes with as well as of those with of either 500 or 5 mm MI in the Barth's solution not the experiments were oocytes with of and the oocytes in Barth's solution 5% The that the rkST1 protein was expressed in the was provided by the presteady-state currents by the of oocytes from the of to levels between and seen in control oocytes a current that within with rkST1 an current that to well the has at a is similar to the presteady-state currents observed with other cotransporter proteins K. A. H.M. Handler J.S. Wright E.M. J. Biol. PubMed Scopus Google Scholar, B. M. Wright E.M. J. Biol. Chem. 1996; 271: Full Text Full Text PDF PubMed Scopus Google Scholar, J. N. H. A. J. Biol. 1997; PubMed Scopus Google Scholar), that an protein has been expressed at the Although not all proteins are likely to be characterized by presteady-state currents expressed in this for all of the SLC5 family members that have been The oocytes rkST1 were with several including glucose and MI, the was at steady-state inward current was associated with to mm MI a much current was associated with to mm with mm a substrate for not current rkST1, a small inward current was by of mm similar to substrate-independent currents seen with other J.A. Coady M.J. Wright E.M. Biophys. J. 1990; Full Text PDF PubMed Scopus Google Scholar, N. J. H. J. Physiol. 1998; 1-18Crossref PubMed Scopus Google Scholar). the protein the currents to MI, we have named SMIT2, and we that the first SMIT protein be SMIT1, with the of the S. current was also observed with superfusion but a small current was seen with of these currents were seen in the of the substrate of this we oocytes with mm of either MI or a of sugars to be to SMIT2 transport with obtained by with SGLT1 and K. A. H.M. Handler J.S. Wright E.M. J. Biol. PubMed Scopus Google Scholar) The contained mm NaCl, and was maintained by the of mm in the of MI or other sugars not currents the by the different levels of SMIT2 expression in the from are expressed as of the current observed mm MI was to the There are several between the substrate specificities of and The most obvious is that SMIT2 has a affinity for does SMIT1, because a current SMIT2 that is over the of the current seen with mm MI but of the MI current is seen is to K. A. H.M. Handler J.S. Wright E.M. J. Biol. PubMed Scopus Google Scholar). SMIT2 exhibits and d-xylose but not of the other sugars with SMIT2 SMIT1, in contrast, and l-xylose (but not and does not between and does between and SMIT2 displays transport of of at mm Although has been to M.A. Dunlap PubMed Scopus Google Scholar), we found no of the SMIT2 current associated with μm MI 5 was to the MI not The current-voltage relationship of SMIT2 was by the currents in the of MI from those observed in the of mm the between the current current was observed in control superfusion of MI a inward current SMIT2, which in as the The current no of a at the most used which is similar to the seen with expression but the of the for SGLT1 K. A. H.M. Handler J.S. Wright E.M. J. Biol. PubMed Scopus Google Scholar). The currents for the sodium associated with SMIT2 were also at different The of this current at is on the of 5% of the current, similar to the of the SGLT1 current J.A. Coady M.J. Wright E.M. Biophys. J. 1990; Full Text PDF PubMed Scopus Google Scholar). The sodium currents at are those seen with SGLT1 J.A. Coady M.J. Wright E.M. Biophys. J. 1990; Full Text PDF PubMed Scopus Google Scholar). have also the of the of The K m for MI 120 over the of to 5 this is as high as the K m for is also The at were found to be because of a small steady-state the found MI or sodium both that to the seen in at the high MI concentration of mm sodium 5 m for sodium was at the most the between the sodium affinities of the SMIT proteins is that the SMIT2 K m an at m seen with to attain a mm K. A. H.M. Handler J.S. Wright E.M. J. Biol. PubMed Scopus Google Scholar). The sodium K for by a that similar to that seen with SMIT2 J.A. Coady M.J. Wright E.M. Biophys. J. 1990; Full Text PDF PubMed Scopus Google Scholar). data was to the and produced a of not which a also be at the K m is and the is identical to that seen with MI The K m is mm at identical to that with to of the to the of Coady M.J. A. J.Y. Biophys. J. Full Text PDF PubMed Scopus Google Scholar). In the of μm MI, of phlorizin were used the current analyzed by a K i of 76 μm was of the current current, and of with MI or with to a we were to the of the Na+/MI current to the of the cotransport protein, as been for SGLT1 Coady M.J. A. J.Y. Biophys. J. Full Text PDF PubMed Scopus Google Scholar). The presteady-state currents associated with SMIT2 expression oocytes were by the currents in the of mm phlorizin from those in the of phlorizin MI was and the sodium concentration was to 30 mm to The presteady-state currents are the is to a are also some steady-state currents by the substrate-independent current that of the presteady-state current produced a which can be with a described by a of a of 3 and of these the of can be at MI of at the be either a of or a of The SMIT2 cDNA was first cloned in by and Tsukagoshi (4Hitomi K. Tsukagoshi N. Biochim. Biophys. Acta. 1994; 1190: 469-472Crossref PubMed Scopus (23) Google Scholar) using PCR with a sequence and within the SLC5 family a protein with and sequence identity to SGLT1 and SMIT1, SMIT2 RNA been in brain, kidney, and (4Hitomi K. Tsukagoshi N. Biochim. Biophys. Acta. 1994; 1190: 469-472Crossref PubMed Scopus (23) Google Scholar, R. U. S. H. M. M. H. J. Neurochem. 1997; PubMed Scopus Google Scholar, Y. J. A. A. Biol. 1996; 20: PubMed Scopus Google Scholar), but the of the protein been the of an orphan cotransporter oocytes can be by first that the protein is expressed at the cell of other orphan proteins have not currents to a of and are examples where this has because the protein was not expressed at the cell expression in oocytes (23Uldry M. Ibberson M. Horisberger J.D. Chatton J.Y. Riederer B.M. Thorens B. EMBO J. 2001; 20: 4467-4477Crossref PubMed Scopus (186) Google Scholar). The presteady-state currents by SMIT2 are and to and that the orphan protein was expressed at the cell SMIT2, expressed in MI with aK m to the 70 μm concentration of MI R. Wieland O.H. J. Clin. Chem. Clin. Biochem. 1987; 25: 733-736PubMed Google Scholar) and well the μm concentration reported for R. Am. J. Physiol. PubMed Scopus Google Scholar) and has a that well with other cotransporters. the K m for glucose is well serum glucose that MI is the substrate for the d-chiro-inositol is transported as as MI, the serum is Jr., R.E. Sherman W.R. Proc. Natl. Acad. Sci. U. S. A. 1993; PubMed Scopus Google Scholar), and d-chiro-inositol transport a for be that has been one previous the SMIT1, SMIT2, and for three transcripts from the Y. T. M. A. M.J. Am. J. Physiol. 1999; 276: PubMed Google Scholar); we that these be named and in which we have the of the of that J. SMIT2 displays that are similar to those of the best studied SMIT2 is has a sodium and presteady-state the sodium is a of sodium for MI and its is of the of the other also The relationship does not at as to be the for SMIT1, a the The affinity from to of the most between and SMIT2 is that SMIT2 displays for the of the most substrates and has no in substrate may be for the functional between the proteins in where they are both expressed in and H.M. Yamauchi A. Uchida S. Preston A.S. Garcia-Perez A. Burg M.B. Handler J.S. J. Biol. Chem. 1992; 267: 6297-6301Abstract Full Text PDF PubMed Google Scholar, Y. J. A. A. Biol. 1996; 20: PubMed Scopus Google Scholar). The lack of transport of by SMIT2 to a in which proteins of the SLC5 family that have a at the to in SGLT1 are to transport the other SLC5 proteins as not transport A. Wright E.M. J. Biol. Chem. 2001; 276: Full Text Full Text PDF PubMed Scopus Google Scholar). described the SMIT2 cDNA sequence and the distribution of SMIT2 expression by A. S. A. PubMed Scopus Google Scholar). SMIT2 to be is not in small and some other In particular, SMIT2 is well expressed in brain, kidney, and In other work, and SMIT2 have been in both in cells and in R. U. S. H. M. M. H. J. Neurochem. 1997; PubMed Scopus Google Scholar). the control of MI uptake into the cells of the has been to be related to the control of a of J. J. M. A. Am. J. PubMed Scopus Google Scholar, M. J. A. Am. J. 1996; PubMed Scopus Google Scholar, J. Y. M. H. A. Am. J. PubMed Scopus Google Scholar), a of the for and SMIT2 in may the of these The that the of SMIT2 has also the of a between this and an of that has been to this region of the but found no between of the and within the SMIT2 to be similar to a cotransporter from HepG2 cells that was previously to transport MI with similar affinities (18Ostlund Jr., R.E. Seemayer R. Gupta S. Kimmel R. Ostlund E.L. Sherman W.R. J. Biol. Chem. 1996; 271: 10073-10078Abstract Full Text Full Text PDF PubMed Scopus (40) Google Scholar). was seen for SMIT2, the novel transporter described in these cell similar K m for the and from but not from The cell line also to SMIT1, that the proteins can in the information is the distribution of the between the different in these of of SMIT2 by that SMIT2 is not involved in several transport between and MI, including Dunlap J.A. T.J. Yorek M.A. 1997; PubMed Scopus Google Scholar). be noted, that SMIT2 has a affinity for glucose does and is likely to be by glucose levels The SMIT2 sequence is most related to protein are SMIT2 is identical to and identical to is to SMIT2 and xSGLT1L by is identity between the SGLT1 and of the proteins is also xSGLT1L both MI and its affinity for MI is that of SMIT2, xSGLT1L has a K m for glucose mm mm for the K i for phlorizin with xSGLT1L is SMIT2 with a K i of 76 μm. The current-voltage for the proteins are also different because to a in the current obtained as the SMIT2, on the other currents as the similar to that seen with SMIT2 also displays sodium currents xSGLT1L has no sodium The that SMIT2 and xSGLT1L different proteins is that the distribution of SMIT2 is in the kidney, and (but not xSGLT1L is found in the and (6Nagata K. Hori N. Sato K. Ohta K. Tanaka H. Hiji Y. Am. J. Physiol. 1999; 276: G1251-G1259PubMed Google Scholar, A. K. J. Biol. Google Scholar). likely that the proteins are but that they serve different in mammals and There have been a of that MI transport in different tissues, and the of SMIT2 may some of these of SMIT2 in The substrate of SMIT2 does that of a transporter that has been observed in renal and H. for the Scholar). the coding for SMIT1, SMIT2, and appear to be from small H.M. Yamauchi A. Uchida S. Preston A.S. Garcia-Perez A. Burg M.B. Handler J.S. J. Biol. Chem. 1992; 267: 6297-6301Abstract Full Text PDF PubMed Google Scholar, M. Ibberson M. Horisberger J.D. Chatton J.Y. Riederer B.M. Thorens B. EMBO J. 2001; 20: 4467-4477Crossref PubMed Scopus (186) Google Scholar, A. S. A. PubMed Scopus Google Scholar), the of the MI transporter to be The of three MI in tissues the of MI in the which has with the of MI as the of of three used to R.S. Nature. PubMed Scopus Google Scholar).

Récupéré en direct depuis OpenAlex et désinversé. Les résumés ne sont pas conservés dans cette base de données : les index inversés représentent 8,6 Go des 9,3 Go de texte de la base, et le serveur dispose de 13 Go libres.