RGC-32 Increases p34CDC2 Kinase Activity and Entry of Aortic Smooth Muscle Cells into S-phase
Pourquoi ce travail est dans la base
Une base qui oublie comment elle a trouvé un travail ne peut pas être vérifiée. Voici les voies qui ont admis celui-ci.
Notice bibliographique
Résumé
Proliferation of aortic smooth muscle cells contributes to atherogenesis and neointima formation. Sublytic activation of complement, particularly C5b-9, induces cell cycle progression in aortic smooth muscle cells. RGC-32 is a novel protein that may promote cell cycle progression in response to complement activation. We cloned human RGC-32 cDNA from a human fetal brain cDNA library. The human RGC-32cDNA encodes a 117-amino acid protein with 92% similarity to the rat and mouse protein. Human RGC-32 maps to chromosome 13 and is expressed in most tissues. Sublytic complement activation enhanced RGC-32 mRNA expression in human aortic smooth muscle cells and induced nuclear translocation of the protein. RGC-32 was physically associated with cyclin-dependent kinase p34CDC2 and increased the kinase activity in vivo and in vitro. In addition, RGC-32 was phosphorylated by p34CDC2-cyclin B1 in vitro.Mutation of RGC-32 protein at Thr-91 prevented the p34CDC2-mediated phosphorylation and resulted in loss of p34CDC2 kinase enhancing activity. Overexpression of RGC-32 induced quiescent aortic smooth muscle cells to enter S-phase. These data indicate that cell cycle activation by C5b-9 may involve p34CDC2 activity through RGC-32. RGC-32 appears to be a cell cycle regulatory factor that mediates cell proliferation, both as an activator and substrate of p34CDC2. Proliferation of aortic smooth muscle cells contributes to atherogenesis and neointima formation. Sublytic activation of complement, particularly C5b-9, induces cell cycle progression in aortic smooth muscle cells. RGC-32 is a novel protein that may promote cell cycle progression in response to complement activation. We cloned human RGC-32 cDNA from a human fetal brain cDNA library. The human RGC-32cDNA encodes a 117-amino acid protein with 92% similarity to the rat and mouse protein. Human RGC-32 maps to chromosome 13 and is expressed in most tissues. Sublytic complement activation enhanced RGC-32 mRNA expression in human aortic smooth muscle cells and induced nuclear translocation of the protein. RGC-32 was physically associated with cyclin-dependent kinase p34CDC2 and increased the kinase activity in vivo and in vitro. In addition, RGC-32 was phosphorylated by p34CDC2-cyclin B1 in vitro.Mutation of RGC-32 protein at Thr-91 prevented the p34CDC2-mediated phosphorylation and resulted in loss of p34CDC2 kinase enhancing activity. Overexpression of RGC-32 induced quiescent aortic smooth muscle cells to enter S-phase. These data indicate that cell cycle activation by C5b-9 may involve p34CDC2 activity through RGC-32. RGC-32 appears to be a cell cycle regulatory factor that mediates cell proliferation, both as an activator and substrate of p34CDC2. terminal complement complex representing C5b-7, C5b-8, and C5b-9 antibody late-acting complement proteins designated by number in sequential order of their activity glutathioneS-transferase normal human serum oligodendrocytes response gene to complement smooth muscle cells bromodeoxyuridine C5b-9, the membrane attack complex of complement, causes cell death by forming transmembrane pores (1Mayer M.M. Proc. Natl. Acad. Sci. U. S. A. 1972; 69: 2954-2958Crossref PubMed Scopus (162) Google Scholar). When the number of C5b-9 molecules is limited to a sublytic level, nucleated cells are able to escape cell death by eliminating membrane-inserted terminal complement complexes (TCC1; C5b-7, C5b-8, and C5b-9) by endocytosis and/or membrane shedding (2Koski C.L. Ramm L.E. Hammer C.H. Mayer M.M. Shin M.L. Proc. Natl. Acad. Sci. U. S. A. 1983; 80: 3816-3820Crossref PubMed Scopus (113) Google Scholar, 3Shin M.L. Rus H.G. Niculescu F.I. Lee A.G. Membrane Attack by Complement: Biomembranes. 4. Jai Press Inc., Greenwich, CT1996: 123-149Google Scholar, 4Morgan B.P. Dankert J.R. Esser A.F. J. Immunol. 1987; 138: 246-253PubMed Google Scholar). Among these complexes, C5b-9 is most potent in activating target cells. C5b-9 causes a Ca2+ influx and generates intracellular second messengers, including phosphatidylinositol triphosphates, diacylglycerol, and ceramide (5Imagawa D.K. Osifchin N.E. Ramm L.E. Koga P.G. Hammer C.H. Shin H.S. Mayer M.M. J. Immunol. 1986; 136: 4637-4643PubMed Google Scholar, 6Wiedmer T. Ando B. Sims P.J. J. Biol. Chem. 1987; 262: 13674-13681Abstract Full Text PDF PubMed Google Scholar, 7Niculescu F. Rus H. Shin S. Lang T. Shin M.L. J. Immunol. 1993; 150: 214-224PubMed Google Scholar, 8Carney D.F. Lang T.J. Shin M.L. J. Immunol. 1990; 145: 623-629PubMed Google Scholar). Membrane-inserted TCC activates the Gi/Go family of G proteins (9Niculescu F. Rus H. Shin M.L. J. Biol. Chem. 1994; 269: 4417-4423Abstract Full Text PDF PubMed Google Scholar). Activation of Gi/Go by TCC is responsible for the Gβγ-mediated activation of cell cycle through activation of Ras, Raf-1, extracellular signal regulated kinase-1 (10Niculescu F. Rus H. Van Biesen T. Shin M.L. J. Immunol. 1997; 158: 4405-4412PubMed Google Scholar), and activation of phosphatidylinositol 3-phosphate kinase (10Niculescu F. Rus H. Van Biesen T. Shin M.L. J. Immunol. 1997; 158: 4405-4412PubMed Google Scholar, 11Niculescu F. Badea T. Rus H. Atherosclerosis. 1999; 142: 47-56Abstract Full Text Full Text PDF PubMed Scopus (92) Google Scholar). Cell cycle activation by C5b-9 is associated with an increase in CDK4, CDK2, and p34CDC2 activities, and this is followed by an increase in DNA synthesis and cell proliferation (11Niculescu F. Badea T. Rus H. Atherosclerosis. 1999; 142: 47-56Abstract Full Text Full Text PDF PubMed Scopus (92) Google Scholar, 12Rus H.G. Niculescu F. Shin M.L. J. Immunol. 1996; 156: 4892-4900PubMed Google Scholar, 24Benzaquen L.R. Nicholson-Weller A. Halperin J.A. J. Exp. Med. 1994; 179: 985-992Crossref PubMed Scopus (213) Google Scholar, 25Halperin J.A. Taratusca A. Nicholson-Weller A. J. Clin. Invest. 1993; 91: 1974-1978Crossref PubMed Scopus (107) Google Scholar, 26Dashiell S.M. Rus H. Koski C.L. Glia. 1998; 30: 187-198Crossref Scopus (44) Google Scholar). The C5b-9-induced DNA synthesis is abolished by inhibitors of mitogen-activated protein kinase/extracellular signal-regulated kinase kinase-1 and phosphatidylinositol 3- phosphate kinase (11Niculescu F. Badea T. Rus H. Atherosclerosis. 1999; 142: 47-56Abstract Full Text Full Text PDF PubMed Scopus (92) Google Scholar). Cell cycle activation by C5b-9 in post-mitotic cells, such as oligodendrocytes (OLG) and myotubes, is associated with expression of c-JUN and c-FOS protooncogenes and loss of differentiation (12Rus H.G. Niculescu F. Shin M.L. J. Immunol. 1996; 156: 4892-4900PubMed Google Scholar, 13Shirazi Y. Rus H.G. Maclin W.B. Shin M.L. J. Immunol. 1993; 150: 4581-4590PubMed Google Scholar, 14Lang T.J. Badea T.C. Wade R. Shin M.L. J. Neurochem. 1997; 68: 1581-1589Crossref PubMed Scopus (23) Google Scholar). In an effort to find novel C5b-9-induced genes involved in cell cycle regulation, we cloned the rat Response Gene toComplement (RGC-32) using mRNA differential display PCR in OLG (15Liang P. Pardee A.B. Liang P. Pardee A.B. Differential Display: A General Protocol. Humana Press, Towota, NJ1997: 3-12Google Scholar, 16Badea T. Niculescu F. Soane L. Shin M.L. Rus H. J. Biol. Chem. 1998; 273: 26977-26981Abstract Full Text Full Text PDF PubMed Scopus (85) Google Scholar). C5b-9 enhanced RGC-32 mRNA expression in primary rat OLG and OLGxC6 glioma cell hybrids (16Badea T. Niculescu F. Soane L. Shin M.L. Rus H. J. Biol. Chem. 1998; 273: 26977-26981Abstract Full Text Full Text PDF PubMed Scopus (85) Google Scholar). This overexpression was associated with an increase in DNA synthesis, suggesting a role of RGC-32 in the cell cycle (16Badea T. Niculescu F. Soane L. Shin M.L. Rus H. J. Biol. Chem. 1998; 273: 26977-26981Abstract Full Text Full Text PDF PubMed Scopus (85) Google Scholar). In this paper we present the cloning of human RGC-32 and experimental evidence indicating the role of RGC-32 in cell cycle activation through regulation of p34CDC2 kinase. In human aortic smooth muscle cells (SMC), complement activation induced nuclear translocation of RGC-32 protein. Overexpression of RGC-32 in aortic SMC increased BrdUrd incorporation and the cell number, and these effects of RGC-32 were further increased when cells were exposed to C5b-9. RGC-32 complexes with p34CDC2-cyclin B1 and increases the kinase activity. This kinase enhancing activity appears to require phosphorylation of RGC-32 at threonine 91 by p34CDC2. These findings identify RGC-32 as a substrate and regulator of p34CDC2. To clone human RGC-32, we screened the NCBI EST data base with the rat rgc-32sequence. Among several homologous human ESTs, an EcoRI fragment of the I.M.A.G.E. clone yy46a05 was used to screen 2 × 105 clones of a Human Fetal Brain 5′-STRETCH PLUS λgt11 cDNA Library (CLONTECH, Palo Alto, CA). In brief, duplicate filters were prepared using Nytran membranes (Schleicher & Schuell). Membranes were hybridized with ratrgc-32 cDNA and exposed to Kodak Biomax x-ray film. Colonies that were positive on both of the duplicate filters were screened again, and DNA was isolated from positive phage clones using Lambda-TRAP PLUS (CLONTECH). The cDNA inserts were amplified by PCR with the Long Distance Insert Screening Amplimer set for λgt11 and KlenTaq polymerase (CLONTECH). The longest PCR product (742 bp) was subcloned into pGEM4 plasmid and amplified in bacteria. The insert was sequenced at the University of Maryland School of Medicine Biopolymer Laboratory. BLASTN searches of the dbEST data base revealed mouse ESTs with a high identity to rat rgc-32. One such EST (ATCC accession number AI787756, clone μl22 g09.y1, mouse embryonic day 14.5) had an insert length of ∼1000 bp. The insert was sequenced in both orientations. PCR was used to screen a monochromosomal somatic cell hybrid panel (Quantum Biotechnology, Inc., Montreal, Canada) containing 20 somatic hybrid cell lines plus 3 control DNAs of human, hamster, and mouse. By using PCR primers, hg5′ (CTGCTAAAATCAGCTTACTAG) and hg3′ (ATATTAGCATGGATCGTCTG), amplification was performed according to the manufacturer's instructions. The PCR products were resolved by agarose gel electrophoresis and confirmed by Southern blot probed with human RGC-32 labeled with [α-32P]dCTP using the oligolabeling kit (Amersham Biosciences). Human aortic SMC from Clonetics (Walkersville, MD) were grown 3–5 passages for 3–4 days in SMC basal medium, containing supplements of 5% fetal bovine serum, 10 ng/ml human epidermal growth factor, 2 ng/ml human fibroblast growth factor, and 5 μg/ml insulin. Prior to the experiments, cells were starved for 24 h in SMC basal medium without serum and growth factor supplements. This method produced over 95% of cells resting in G0/G1-phase, as determined by the relative DNA content by propidium iodide staining and fluorescence-activated cell sorter analysis (12Rus H.G. Niculescu F. Shin M.L. J. Immunol. 1996; 156: 4892-4900PubMed Google Scholar). All cells were positive for muscle actin by indirect immunostaining using HHF35 monoclonal IgG (Enzo Diagnostics, Farmingdale, NY) Pooled normal human serum (NHS) from healthy adult donors was used as a source of serum complement. Aortic SMC were exposed to sublytic complement attack by sensitizing with a fixed dose of anti-HLA class I antibody (Ab) and then incubating with NHS at 1:10 final dilution. The sublytic dose of Ab was predetermined by measuring cell death in the presence of excess NHS (8Carney D.F. Lang T.J. Shin M.L. J. Immunol. 1990; 145: 623-629PubMed Google Scholar, 10Niculescu F. Rus H. Van Biesen T. Shin M.L. J. Immunol. 1997; 158: 4405-4412PubMed Google Scholar, 11Niculescu F. Badea T. Rus H. Atherosclerosis. 1999; 142: 47-56Abstract Full Text Full Text PDF PubMed Scopus (92) Google Scholar). To produce a negative control for complement activity of NHS, the hemolytic activity was inactivated by heating NHS at 56 °C for 45 min (HI-NHS). C5b-9 was assembled by incubating aortic SMC sequentially with C5b6 complex for 15 min and C7 for 5 min at room temperature, and then with C8 and C9 at 37 °C for the indicated period, as previously described (9Niculescu F. Rus H. Shin M.L. J. Biol. Chem. 1994; 269: 4417-4423Abstract Full Text PDF PubMed Google Scholar, 10Niculescu F. Rus H. Van Biesen T. Shin M.L. J. Immunol. 1997; 158: 4405-4412PubMed Google Scholar). Purified C5-C9 proteins were from Quidel (San Diego, CA), and C5b6 was prepared as described (9Niculescu F. Rus H. Shin M.L. J. Biol. Chem. 1994; 269: 4417-4423Abstract Full Text PDF PubMed Google Scholar, 10Niculescu F. Rus H. Van Biesen T. Shin M.L. J. Immunol. 1997; 158: 4405-4412PubMed Google Scholar). Total RNA was purified from aortic SMC using guanidine isothiocyanate and ultracentrifugation through a 5.7 m CsCl2cushion for 18 h at 35,000 rpm using an SW60 Beckman rotor (12Rus H.G. Niculescu F. Shin M.L. J. Immunol. 1996; 156: 4892-4900PubMed Google Scholar,17Chirgwin J.M. Przybyla A.E. MacDonald R.J. Rutter W.J. Biochemistry. 1979; 18: 5294-5299Crossref PubMed Scopus (16653) Google Scholar). RNA was denatured and electrophoresed (10 μg of RNA/lane) on 0.8% agarose-formaldehyde gel and then transferred to nitrocellulose. A multitissue Northern blot (MTN1,CLONTECH, containing 2 μg of human poly(A)+ RNA per lane) was hybridized with32P-labeled probe generated from the 855-bpRGC-32 cDNA (18Thomas P.S. Proc. Natl. Acad. Sci. U. S. A. 1980; 77: 5201-5205Crossref PubMed Scopus (5860) Google Scholar). After exposure to x-ray film, radiographic densities of each mRNA band were measured using Computing Densitometer (Molecular Dynamics, Inc., Sunnyvale, CA), and the integrated volume was calculated using ImageQuant software (Molecular Dynamics). The human RGC-32 open reading frame was subcloned into the pGEX-4T-3 vector (Amersham Biosciences) in frame with the GST gene. Recombinant fusion protein (GST-RGC-32) extracted from bacterial lysates was purified by chromatography using Redipack GST purification module (Amersham Biosciences). were by with IgG of were screened by (16Badea T. Niculescu F. Soane L. Shin M.L. Rus H. J. Biol. Chem. 1998; 273: 26977-26981Abstract Full Text Full Text PDF PubMed Scopus (85) Google Scholar). To protein from human and were on and then by with IgG by indirect method and by aortic SMC grown on in SMC basal medium without serum and growth factor supplements were fixed and with IgG by indirect method using The of complement activation was by cells in with Ab and in B1 complex was with GST at a final of 5 After min at room temperature, were with 20 of of in for and were with on the was with and by using IgG Biotechnology, CA). in vivo aortic SMC lysates with C5b-9 C5b6 for and 18 h were with IgG and then by Human p34CDC2-cyclin B1 was used to the of RGC-32. was with of p34CDC2-cyclin B1 for min at 37 °C in the presence of 2 μg of and of in 10 Recombinant cell cycle kinase Diego, (10 was in were by and (11Niculescu F. Badea T. Rus H. Atherosclerosis. 1999; 142: 47-56Abstract Full Text Full Text PDF PubMed Scopus (92) Google Scholar, 12Rus H.G. Niculescu F. Shin M.L. J. Immunol. 1996; 156: 4892-4900PubMed Google Scholar). Purified p34CDC2-cyclin and of were for min at 37 as described and proteins were for phosphorylation on and Thr-91 of RGC-32, a target for p34CDC2 Cell Biol. Google Scholar, D.F. J. 1998; PubMed Scopus Google Scholar), was using the kit The at in pGEX-4T-3 to a was Thr-91 to The was confirmed by DNA at the University Biopolymer and RGC-32 proteins were used in for kinase and phosphorylation The cDNA was subcloned in frame with and in CA). the RGC-32 gene vector were into aortic SMC using CA). BrdUrd incorporation was performed in cells using BrdUrd Diego, CA). In brief, aortic SMC were labeled with 10 by and then with by the BrdUrd and DNA were with isothiocyanate and according to the manufacturer's instructions. analysis and cells that are DNA in cell analysis was performed using a and In searches of the dbEST and data with rat was with human EST clones and from a human brain F. Rus H. Shin S. Lang T. Shin M.L. J. Immunol. 1993; 150: 214-224PubMed Google Scholar). The that rat (16Badea T. Niculescu F. Soane L. Shin M.L. Rus H. J. Biol. Chem. 1998; 273: 26977-26981Abstract Full Text Full Text PDF PubMed Scopus (85) Google and these human clones over DNA identity that the EST may be of the human RGC-32 gene. We used an EcoRI fragment from EST clone yy46a05 to screen a human fetal brain cDNA library. One of the isolated clones had a insert containing the and the open reading frame of rgc-32. of this clone with the EST produced an the of the human RGC-32 on Northern The a 117-amino acid with an of Human RGC-32 the 20 at the of the rat (16Badea T. Niculescu F. Soane L. Shin M.L. Rus H. J. Biol. Chem. 1998; 273: 26977-26981Abstract Full Text Full Text PDF PubMed Scopus (85) Google and mouse protein this human RGC-32 92% similarity with the rat protein (16Badea T. Niculescu F. Soane L. Shin M.L. Rus H. J. Biol. Chem. 1998; 273: 26977-26981Abstract Full Text Full Text PDF PubMed Scopus (85) Google Scholar). RGC-32 accession number is a gene with a at and a poly(A)+ signal at The gene encodes a acid with 92% identity to rat RGC-32, including the 20 By data base human and mouse RGC-32 with proteins and that indicate a Human and mouse RGC-32 signal transmembrane as determined by Human RGC-32 was to chromosome 13 by a monochromosomal somatic cell hybrid panel using followed by by Southern blot When the human was with the data base of the using we an identity with a human The hybrid of this through the Human confirmed that human RGC-32 on the of chromosome 13 in and was in the NCBI data base to in the The human RGC-32 cDNA was used to probe a human multitissue Northern blot was expressed in and and was expressed in and signal was in The mRNA was in human aortic cells and RGC-32 IgG a band by blot of the and RGC-32 and RGC-32 protein in and expression of mouse mRNA was to that of rat mRNA (16Badea T. Niculescu F. Soane L. Shin M.L. Rus H. J. Biol. Chem. 1998; 273: 26977-26981Abstract Full Text Full Text PDF PubMed Scopus (85) Google the of RGC-32 mRNA expressed in aortic SMC was by Northern increased to a by with C5b-9 The 3 h exposure to C5b-9, for to h and was at 18 a negative control for C5b-9, had on RGC-32 on the revealed the presence of RGC-32 as a protein in cells in with Ab and NHS, nuclear translocation of RGC-32 protein was as as h translocation of RGC-32 may an role in nuclear regulation of the cell as nuclear translocation of RGC-32 DNA synthesis and SMC proliferation at and h complement (11Niculescu F. Badea T. Rus H. Atherosclerosis. 1999; 142: 47-56Abstract Full Text Full Text PDF PubMed Scopus (92) Google Scholar). In of the protein a Northern blot may be to RGC-32 mRNA in This is in with that was to an increased mRNA in rat OLG in response to C5b-9 (16Badea T. Niculescu F. Soane L. Shin M.L. Rus H. J. Biol. Chem. 1998; 273: 26977-26981Abstract Full Text Full Text PDF PubMed Scopus (85) Google Scholar). To the role of RGC-32 in cell cycle a of RGC-32 with p34CDC2 was by GST p34CDC2 was with RGC-32 in GST GST was to p34CDC2. We then RGC-32 with vivo by and We that p34CDC2 was with RGC-32 both in and aortic SMC By the of RGC-32 with appears in cells with C5b-9 in the C5b6 control RGC-32 to with with of RGC-32 with p34CDC2 to the regulation of kinase by RGC-32. We with p34CDC2-cyclin B1 and then kinase activity using RGC-32 increased the p34CDC2 activity in a is by cell cycle kinase A. J. A. S. J. Biol. Chem. 1997; Full Text Full Text PDF PubMed Scopus Google Scholar), we the RGC-32 kinase enhancing activity in the presence of RGC-32 was to increase the p34CDC2 kinase activity in the presence of at 10 RGC-32 p34CDC2 and kinase activity on the in kinase to the of RGC-32, we that RGC-32 was In the of p34CDC2-cyclin B1 induced phosphorylation of and the protein complex was as a band A and This p34CDC2-mediated phosphorylation was by and RGC-32 was RGC-32, was phosphorylated by p34CDC2 in the of We for a p34CDC2 phosphorylation in human RGC-32. The a at the Cell Biol. Google Scholar, D.F. J. 1998; PubMed Scopus Google Scholar). We a p34CDC2 with a threonine at a at and a at the A was in the rat and mouse To Thr-91 is the phosphorylation the was to and the GST fusion protein was expressed in The protein was purified and used to the role of of RGC-32. in p34CDC2 to RGC-32 These data indicate that Thr-91 may be the target for p34CDC2 kinase. These data indicate that RGC-32 is for phosphorylation of B1 by p34CDC2. of a role in nuclear of the p34CDC2-cyclin complex P. S. L. J. Biol. Chem. 1994; 269: Full Text PDF PubMed Google Scholar). RGC-32 was phosphorylated by we of Thr-91 the of RGC-32 to the activity of p34CDC2 The the kinase enhancing activity of RGC-32. phosphorylation of Thr-91 appears to be for RGC-32 in the kinase activity. the cell cycle activation in OLG by C5b-9 is associated with a protein J. H. S. S. J. Biol. Chem. Full Text Full Text PDF PubMed Scopus Google Scholar), the p34CDC2 enhancing of RGC-32 be amplified by C5b-9 in vivo through of We to RGC-32 is involved in the cell cycle by using aortic SMC to RGC-32. 95% of cells were in the of the cell cycle 18 h of After cells were for an 18 h in and growth medium, and then DNA synthesis was by BrdUrd incorporation and DNA content using The were on (11Niculescu F. Badea T. Rus H. Atherosclerosis. 1999; 142: 47-56Abstract Full Text Full Text PDF PubMed Scopus (92) Google Scholar). 18 h increased cell of control vector resulted in of cells in of RGC-32 expression vector induced of cells to enter and of cells in When cells to RGC-32 were exposed to complement a number of cells from into These data indicate for the that RGC-32 is able to and in the of serum and growth and that RGC-32 is involved in cell proliferation (11Niculescu F. Badea T. Rus H. Atherosclerosis. 1999; 142: 47-56Abstract Full Text Full Text PDF PubMed Scopus (92) Google Scholar). When aortic SMC were with RGC-32 expression vector in the presence of a H. T. H. Y. S. A. 1994; Google Scholar), BrdUrd incorporation was to the of control vector findings are with an of p34CDC2 in RGC-32 and This is with that C5b-9 increased p34CDC2 activity in primary OLG (12Rus H.G. Niculescu F. Shin M.L. J. Immunol. 1996; 156: 4892-4900PubMed Google Scholar). A role of p34CDC2 in regulation of p34CDC2-cyclin is able to DNA through phosphorylation of DNA factor A. B. J. PubMed Scopus Google Scholar, J.M. 1990; PubMed Scopus Google Scholar). p34CDC2 DNA by of a kinase involved in J. Proc. Natl. Acad. Sci. U. S. A. 1999; PubMed Scopus Google Scholar, H. Y. J. Biol. Chem. Full Text Full Text PDF PubMed Scopus Google Scholar). p34CDC2 may the of cell cycle in aortic in to role in the (12Rus H.G. Niculescu F. Shin M.L. J. Immunol. 1996; 156: 4892-4900PubMed Google Scholar, J.M. Biol. PubMed Scopus Google Scholar, Y. H. T.J. Y. 1990; PubMed Scopus Google Scholar, H.G. Niculescu F. Shin M.L. Clin. Exp. 1997; Scholar). In the present we experimental data to the role of RGC-32 in the cell We that RGC-32 p34CDC2 and increases the activity of the kinase. of these to on phosphorylation of RGC-32 by p34CDC2 at a at RGC-32 is a p34CDC2 substrate that increase the kinase activity and P. 1997; 91: Full Text Full Text PDF PubMed Scopus Google Scholar). Proliferation of aortic SMC a role in atherogenesis and in and R. J. Med. 1999; PubMed Scopus Google Scholar, R. T. A. A.E. 1998; PubMed Scopus Google Scholar). Proliferation of SMC be by cell cycle including p34CDC2 PubMed Scopus Google Scholar, R. L. Y. T. Proc. Natl. Acad. Sci. U. S. A. 1993; PubMed Scopus Google Scholar). RGC-32 may as a target to the proliferation of an to in the of and We for in cell and for of the
Récupéré en direct depuis OpenAlex et désinversé. Les résumés ne sont pas conservés dans cette base de données : les index inversés représentent 8,6 Go des 9,3 Go de texte de la base, et le serveur dispose de 13 Go libres.
Prédiction distillée sur la base complète
Imitation des enseignantsNi prévalence calibrée, ni vérité terrain. Validation humaine à venir. Apprise à partir de 10 348 étiquettes directes de Codex et de 10 348 étiquettes directes de Gemma. Le mode candidate est l'union des têtes enseignantes seuillées; le consensus est leur intersection. Ces sorties portent le statut machine_predicted_unvalidated et ne sont ni des étiquettes humaines ni des étiquettes directes de modèles de pointe.
Scores Codex et Gemma par catégorie
| Catégorie | Codex | Gemma |
|---|---|---|
| Métarecherche | 0,000 | 0,001 |
| Méta-épidémiologie (sens strict) | 0,000 | 0,000 |
| Méta-épidémiologie (sens large) | 0,000 | 0,000 |
| Bibliométrie | 0,000 | 0,000 |
| Études des sciences et des technologies | 0,000 | 0,000 |
| Communication savante | 0,000 | 0,000 |
| Science ouverte | 0,000 | 0,000 |
| Intégrité de la recherche | 0,000 | 0,000 |
| Charge utile insuffisante (le modèle a refusé de juger) | 0,001 | 0,000 |
Scores machine (provisoires)
Les deux têtes enseignantes du modèle étudiant, lues sur ce travail. Un score ordonne la base pour la relecture; il n'affirme jamais une catégorie, et le statut de validation accompagne chaque rangée tel quel.
Scores de référence d'un modèle non mature (critères de maturité non atteints, 7 itérations). Un score ordonne; il n'affirme jamais une catégorie.
score_only:v0-immature-baseline · tel quel depuis la passe de notation : score_only signifie que le nombre peut ordonner les travaux, et qu'aucune étiquette de catégorie n'en découle