MUC1 Initiates a Calcium Signal after Ligation by Intercellular Adhesion Molecule-1

The MUC1 mucin is normally restricted to the apical surface of breast epithelial cells. In tumors, it is frequently overexpressed and underglycosylated. The MUC1 peptide core mediates firm adhesion of tumor cells to adjacent cells via binding to intercellular adhesion molecule-1 (ICAM-1). There is increasing evidence that MUC1 is involved in signaling, with current reports focusing on phosphorylation of the MUC1 cytoplasmic tail after indirect or artificial modes of stimulation. ICAM-1 is the only known direct ligand of the MUC1 extracellular domain. The data presented herein show that MUC1 expressed on the surface of breast cancer cell lines or transfected 293T cells can initiate a calcium-based oscillatory signal on contact with ICAM-1-transfected NIH 3T3 cells, and we present a novel method of quantifying and comparing calcium oscillations. The MUC1-induced signal appears to be distinct from those previously described, and may involve a Src family kinase, phosphoinositol 3-kinase, phospholipase C, and lipid rafts, but not mitogen-activated protein kinase. As calcium signaling has been associated with cytoskeletal change and motility, it is possible that the functions of MUC1 include heterotypic cell-cell adhesion followed by a calcium-based promigratory signal within tumor cells, thus facilitating metastasis. The MUC1 mucin is normally restricted to the apical surface of breast epithelial cells. In tumors, it is frequently overexpressed and underglycosylated. The MUC1 peptide core mediates firm adhesion of tumor cells to adjacent cells via binding to intercellular adhesion molecule-1 (ICAM-1). There is increasing evidence that MUC1 is involved in signaling, with current reports focusing on phosphorylation of the MUC1 cytoplasmic tail after indirect or artificial modes of stimulation. ICAM-1 is the only known direct ligand of the MUC1 extracellular domain. The data presented herein show that MUC1 expressed on the surface of breast cancer cell lines or transfected 293T cells can initiate a calcium-based oscillatory signal on contact with ICAM-1-transfected NIH 3T3 cells, and we present a novel method of quantifying and comparing calcium oscillations. The MUC1-induced signal appears to be distinct from those previously described, and may involve a Src family kinase, phosphoinositol 3-kinase, phospholipase C, and lipid rafts, but not mitogen-activated protein kinase. As calcium signaling has been associated with cytoskeletal change and motility, it is possible that the functions of MUC1 include heterotypic cell-cell adhesion followed by a calcium-based promigratory signal within tumor cells, thus facilitating metastasis. The MUC1 mucin has been well established as a tumor marker in breast cancer and is implicated in metastatic spread (1Rahn J.J. Dabbagh L. Pasdar M. Hugh J.C. Cancer. 2001; 91: 1973-1982Crossref PubMed Scopus (203) Google Scholar). Phosphorylation of the MUC1 cytoplasmic tail (2Wang H. Lillehoj E.P. Kim K.C. Biochem. Biophys. Res. Commun. 2003; 310: 341-346Crossref PubMed Scopus (51) Google Scholar, 3Zrihan-Licht S. Baruch A. Elroy-Stein O. Keydar I. Wreschner D.H. FEBS Lett. 1994; 356: 130-136Crossref PubMed Scopus (138) Google Scholar, 4Quin R.J. McGuckin M.A. Int. J. Cancer. 2000; 87: 499-506Crossref PubMed Scopus (65) Google Scholar) allows MUC1 to associate with potential oncogenes (5Li Y. Kuwahara H. Ren J. Wen G. Kufe D. J. Biol. Chem. 2001; 276: 6061-6064Abstract Full Text Full Text PDF PubMed Scopus (205) Google Scholar, 6Li Y. Bharti A. Chen D. Gong J. Kufe D. Mol. Cell. Biol. 1998; 18: 7216-7224Crossref PubMed Scopus (222) Google Scholar, 7Yamamoto M. Bharti A. Li Y. Kufe D. J. Biol. Chem. 1997; 272: 12492-12494Abstract Full Text Full Text PDF PubMed Scopus (280) Google Scholar, 8Pandey P. Kharbanda S. Kufe D. Cancer Res. 1995; 55: 4000-4003PubMed Google Scholar). MUC1 can also be indirectly stimulated to initiate signaling cascades, through epidermal growth factor receptor (EGFR) 1The abbreviations used are: EGFR, epidermal growth factor receptor; MAPK, mitogen-activated protein kinase; ERK, extracellular signal-related kinase; ICAM-1, intercellular adhesion molecule-1; FBS, fetal bovine serum; YFP, yellow fluorescent protein; EYFP, enhanced YFP; DIC, differential interference contrast; IP3, inositol trisphosphate; ROI, regions of interest; MOPC, mineral oil plasmacytoma; PBS, phosphate-buffered saline; PI, phosphoinositol; CD, cytoplasmic domain; PLC, phospholipase C; PP2, (3-(4-chlorophenyl)-1-(1,1-dimethylethyl)-1H-pyrazolo[3,4-d]pyrimidin-4-amine; 2-APB, aminoethoxydiphenylborane.1The abbreviations used are: EGFR, epidermal growth factor receptor; MAPK, mitogen-activated protein kinase; ERK, extracellular signal-related kinase; ICAM-1, intercellular adhesion molecule-1; FBS, fetal bovine serum; YFP, yellow fluorescent protein; EYFP, enhanced YFP; DIC, differential interference contrast; IP3, inositol trisphosphate; ROI, regions of interest; MOPC, mineral oil plasmacytoma; PBS, phosphate-buffered saline; PI, phosphoinositol; CD, cytoplasmic domain; PLC, phospholipase C; PP2, (3-(4-chlorophenyl)-1-(1,1-dimethylethyl)-1H-pyrazolo[3,4-d]pyrimidin-4-amine; 2-APB, aminoethoxydiphenylborane. (9Schroeder J.A. Thompson M.C. Gardner M.M. Gendler S.J. J. Biol. Chem. 2001; 276: 13057-13064Abstract Full Text Full Text PDF PubMed Scopus (289) Google Scholar, 10Schroeder J.A. Adriance M.C. Thompson M.C. Camenisch T.D. Gendler S.J. Oncogene. 2003; 22: 1324-1332Crossref PubMed Scopus (149) Google Scholar) or antibodies directed against CD8-MUC1 chimeras (11Meerzaman D. Shapiro P.S. Kim K.C. Am. J. Physiol. 2001; 281: L86-L91PubMed Google Scholar, 12Meerzaman D. Xing P.X. Kim K.C. Am. J. Physiol. 2000; 278: L625-L629Google Scholar), resulting in activation of the mitogen-activated protein kinase (MAPK)/extracellular signal-related kinase (ERK) pathway. Our laboratory has previously identified intercellular adhesion molecule-1 (ICAM-1) as a natural, endogenous ligand for MUC1 (13Regimbald L.H. Pilarski L.M. Longenecker B.M. Reddish M.A. Zimmermann G. Hugh J.C. Cancer Res. 1996; 56: 4244-4249PubMed Google Scholar, 14Kam J.L. Regimbald L.H. Hilgers J.H. Hoffman P. Krantz M.J. Longenecker B.M. Hugh J.C. Cancer Res. 1998; 58: 5577-5581PubMed Google Scholar). ICAM-1 is currently the only reported direct ligand for the MUC1 extracellular domain, and binding promotes adhesion of tumor cells to a simulated vessel wall construct under fluid flow conditions (15.Horne, G. (1999) The Role of Breast Cancer Associated MUC1 in Tumor Cell Recruitment to Vascular Endothelium during Physiological Fluid Flow. M.Sc. thesis, University of Alberta, Edmonton, Alberta, CanadaGoogle Scholar). In this report, we demonstrate a novel signaling paradigm, in which MUC1 participates in initiating intracellular calcium oscillations after direct stimulation by ICAM-1. As calcium signaling has previously been implicated in cytoskeletal remodeling and motility (16Feldner J.C. Brandt B.H. Exp. Cell Res. 2002; 272: 93-108Crossref PubMed Scopus (86) Google Scholar), we hypothesize that this signal is involved in tumor cell migration. Thus, the MUC1/ICAM-1 interaction may facilitate extravasation of tumor cells after mediating binding to the blood vessel wall. Reagents—The CT2 antibody against the MUC1 cytoplasmic domain and the pC1Neo TR+ FLAG plasmid carrying the MUC1 gene were generously provided by Dr. Sandra Gendler, Mayo Clinic, Scottsdale, AZ. The MUC1 gene was PCR amplified from the plasmid and inserted into the Clontech pEYFP-N1 plasmid at the BsrGI/NotI cut sites. A synthetic MUC1-specific signal sequence, TCGACTAGGCCTATGACACCGGGCACCCAGTCTCCTTTCTTCCTGCTGCTGCTCCTCACAGTGCTTACAGTTGTTACG, made by the DNA Core Services Laboratory, Biochemistry Department, University of Alberta, was inserted into the multiple cloning site. Fluo-3 was from Molecular Probes. Pluronic F-127, U-73122, U-73343, methyl-β-cyclodextrin, nystatin, wortmannin, MOPC C31 mouse IgG1 isotype control antibody, anti-tubulin B-5-1-2 antibody, and gelatin were from Sigma. PD98059 was from Calbiochem. PP2 and 2-APB were from Tocris. B27.29 antibody against the MUC1 extracellular domain was a gift from Biomira, Inc. ICR5 antibody against human ICAM-3 was a gift of ICOS Corp. Goat anti-mouse phycoerythrin secondary antibody was purchased from Southern Biotechnology Associates, Inc. Goat anti-mouse or anti-Armenian hamster peroxidase-conjugated antibodies were purchased from Jackson ImmunoResearch. ECL Plus was from Amersham Biosciences. FBS and culture media were from Invitrogen. Cells—293T human embryonic kidney epithelial cells were from the ATCC and were transfected with pEYFP-N1/MUC1. These were designated SYM followed by a number indicating subclone identity. For this particular study, five subclones were selected. Cells expressing the YFP tag were not sufficiently fluorescent to interfere with Fluo-3 imaging. T47D, MCF-7, MDA-MB-468, and Hs578T human breast cancer cells were also from the ATCC. Mock- and ICAM-1-transfected NIH 3T3 mouse fibroblast cells were a generous gift of Dr. Ken Dimock, University of Ottawa, Ontario, Canada. Calcium Oscillation Assay—3-cm glass-bottomed dishes were purchased from MatTek. The glass bottoms were coated with 100 μl of FBS (for untransfected cell lines) or a solution of 0.1% (w/v) gelatin in water (for 293T cells). 100 μl of untransfected cell suspension at 1 × 105/ml or MUC1-transfected 293T cells at 5 × 104/ml were plated onto coated cover glasses and allowed to equilibrate overnight. This generally resulted in ∼60% cell confluence the next day. The medium was aspirated from plated cells, and a 1:1 mixture of 5 mm Fluo-3 in Me2SO:20% (w/v) Pluronic F-127 in Me2SO, diluted 1/1000 in Dulbecco's modified Eagle's medium + 10% FBS was pipetted over the cells. The plated cells were then incubated with Fluo-3 for 1 h at 37 °C, 5% CO2. Where indicated, cells were then incubated with 10 μm PD98059, PP2, U-73122, or U-73343, 15 mm methyl-β-cyclodextrin, 75 μg/ml nystatin, 2 μm wortmannin, or 100 μm 2-APB for 30 min at 37 °C, 5% CO2. Cells were washed once in 37 °C imaging buffer (152 mm NaCl, 5.4 mm KCl, 0.8 mm MgCl2, 1.8 mm CaCl2, 10mm HEPES, 5.6 mm glucose, pH 7.2 (17Oosawa Y. Imada C. Furuya K. Cell Biochem. Funct. 1997; 15: 113-117Crossref PubMed Scopus (7) Google Scholar)), then left in imaging buffer at 37 °C for 30–45 min until imaged. For the antibody blockade experiments, this buffer contained either B27.29 (MUC1 block) or ICR5 (irrelevant block) at 120 μg/ml for 293T MUC1 transfectants and either B27.29 or MOPC C31 (irrelevant block) at 60 μg/ml for T47D cells. NIH 3T3 ICAM-1 or mock transfectants were trypsinized and resuspended in imaging buffer at ∼1.2 × 107/ml. Immediately before photographing, the imaging buffer was decanted, and if blocking antibodies were used, the cells were gently rinsed with warmed imaging buffer. The MatTek dish was then placed in a microscope stage warmer set to 37 °C on a Zeiss Axioscope Digital Imaging Microscope. Using Metamorph software (Universal Imaging Corp.), a DIC image was recorded, then 60 images at 3-s intervals were recorded under the fluorescein isothiocyanate filter. 100 μl of NIH 3T3 cell suspension was added to the plated cells immediately after the first fluorescein isothiocyanate image was taken so that the calcium flux response of the plated cells was recorded in the remaining 59 images. A final DIC image was taken at the end of the time course to ensure that all plated cells had been covered by the NIH 3T3 cells. In the “reverse” model, NIH 3T3 mock- or ICAM-1-transfected cells were plated on the dish and grown to confluence. MCF-7 cells were loaded with Fluo-3 while in tissue culture flasks, then washed, trypsinized, and resuspended in imaging buffer at ∼5 × 105/ml. MCF-7 cells were then added to the NIH 3T3 cells during imaging. Data Analysis—Using Metamorph software, the images taken for each test condition were built into a stack, and 40 random cells per condition were circled (circled areas = regions of interest or ROI). The changes in average fluorescence intensity for each ROI were graphed over time and exported to MS Excel. Each condition was repeated at least three times, n = a minimum of 120. MS Excel was used to plot the data and calculate the “oscillation factors,” which are defined as the number of oscillation cycles multiplied by the “amplitude factor” for each ROI. The number of oscillation cycles was counted manually from the plotted data. The amplitude factors were calculated by plotting an Excel “LOGEST” trend line (y = intercept × slopex) through the oscillatory portion of the data, then calculating the absolute value of the difference between the actual plotted data and the trend line for each data point; the sum of these differences was defined as the amplitude factor (Fig. 1D). Western Blotting—Cells were lysed in RIPA buffer (150 mm NaCl, 1% Nonidet P-40, 0.5% deoxycholic acid, 0.1% SDS, 5 μl/ml Sigma protease inhibitor cocktail, 50 mm Tris, pH 7.6 (4Quin R.J. McGuckin M.A. Int. J. Cancer. 2000; 87: 499-506Crossref PubMed Scopus (65) Google Scholar)) and subjected to shearing with a 26-gauge needle. Insoluble materials were pelleted, and the supernatant was assessed for protein concentration using the Bio-Rad DC assay kit. Equal amounts of protein for each test sample were loaded onto polyacrylamide gels. Resolved gels were transferred to Immobilon-P or PSQ membranes and probed with B27.29 or CT2 antibodies, respectively, followed by a peroxidase-conjugated secondary antibody. Specific labeling was visualized with ECL Plus, and imaged using a Typhoon 9400 Variable Mode Imager and ImageQuant 5.2 Software (Amersham Biosciences). Membranes were re-probed for tubulin as a loading control. Flow Cytometry—Cells were trypsinized, washed one time in FBS-containing medium, then divided into three aliquots, each of which was incubated with one of 2% bovine serum albumin, 0.02% Tween 20 in Tris-buffered saline (BTT, unlabeled control), 5 μg/ml MOPC 31C in BTT (isotype control), or 5 μg/ml B27.29 in BTT, on ice for 1 h in a volume of 30 μl. Cells were washed in a 50× volume of cold PBS, then resuspended in 30 μl of BTT (unlabeled control) or 30 μl of phycoerythrin secondary, 2 μg/ml in BTT for a further 1 h in the dark on ice. Cells were again washed in a 50× volume of cold PBS, then resuspended in 300 μl of PBS and treated with final concentrations of 120 units/ml DNase I and 4.2 mm MgCl2 for 15 min at room temperature. Samples were stored at 4 °C in the dark until analyzed by flow cytometry. At least 10,000 events were recorded on the FL2 (phycoerythrin) channel. As the cells were chilled, unfixed, and unpermeabilized, only surface MUC1 was stained. Statistical Analysis—The Newman-Keuls multiple range comparison was used to determine statistical differences in data sets where there were more than two conditions. Otherwise, the Student's t test was Calcium in Cells and on with Cells—293T cells, which endogenous were transfected with the MUC1 construct in and a of subclones designated as SYM were that a calcium-based response in cells was more and oscillatory these cells into contact with ICAM-1-transfected NIH 3T3 cells, as with cells. In cells, a subclone not expressing the calcium-based not oscillations of the of ICAM-1. of the fluorescence over time (Fig. show more the difference in the cells and also demonstrate that in cells the calcium-based to the NIH 3T3 ICAM-1 or mock cells are to that in the cells ICAM-1 was cells within a there were in the oscillation that be into oscillation factors (Fig. to facilitate between conditions. 40 cells were for each on the DIC or a of the fluorescent images over the time The oscillation factors for a of 120 cells then be and with test conditions. This potential in in a cell of MUC1 to an Calcium of human breast cancer cell lines a of oscillatory in the calcium oscillation assay (Fig. of these cell T47D and MCF-7, differences in a t test comparing oscillation factors resulting from contact with NIH 3T3 ICAM-1 or NIH 3T3 mock transfectants A model, in which MCF-7 cells in suspension were added to NIH 3T3 ICAM-1 or mock transfectants that the MCF-7 cells only on contact with ICAM-1 expressing cells not thus the cells not to be to A of SYM cells expressing of MUC1 also oscillatory after contact with cells in comparison with mock transfectants Western for the of the extracellular and cytoplasmic of MUC1 in all cell lines that a trend between of MUC1 and oscillatory response was (Fig. flow that the had surface was than that on cells (Fig. This that only surface MUC1 is to with ICAM-1 to initiate the calcium and there may be a of MUC1 to a The of MUC1 in the calcium-based signal was by SYM or T47D cells with or antibodies (Fig. with which has previously been to MUC1/ICAM-1 (13Regimbald L.H. Pilarski L.M. Longenecker B.M. Reddish M.A. Zimmermann G. Hugh J.C. Cancer Res. 1996; 56: 4244-4249PubMed Google Scholar, 14Kam J.L. Regimbald L.H. Hilgers J.H. Hoffman P. Krantz M.J. Longenecker B.M. Hugh J.C. Cancer Res. 1998; 58: 5577-5581PubMed Google Scholar), the oscillatory cells with an antibody. of the MUC1/ICAM-1 Calcium cells were treated with PD98059 3-kinase, MAPK, and or PP2 Src family and with an control in the calcium oscillation and PP2, but not PD98059, the of oscillations in the of MUC1 and ICAM-1 to one or of the were (Fig. 2-APB inositol calcium from the and phospholipase but not of also oscillatory (Fig. of lipid by and also calcium oscillations in the cells (Fig. The MUC1 is in all breast with in and The of MUC1 is also the protein in laboratory (13Regimbald L.H. Pilarski L.M. Longenecker B.M. Reddish M.A. Zimmermann G. Hugh J.C. Cancer Res. 1996; 56: 4244-4249PubMed Google Scholar, 14Kam J.L. Regimbald L.H. Hilgers J.H. Hoffman P. Krantz M.J. Longenecker B.M. Hugh J.C. Cancer Res. 1998; 58: 5577-5581PubMed Google Scholar) has on the of MUC1 in metastasis. reported that tumor cell MUC1 can to cell ICAM-1 (13Regimbald L.H. Pilarski L.M. Longenecker B.M. Reddish M.A. Zimmermann G. Hugh J.C. Cancer Res. 1996; 56: 4244-4249PubMed Google Scholar, 14Kam J.L. Regimbald L.H. Hilgers J.H. Hoffman P. Krantz M.J. Longenecker B.M. Hugh J.C. Cancer Res. 1998; 58: 5577-5581PubMed Google Scholar) with to to blood flow (15.Horne, G. (1999) The Role of Breast Cancer Associated MUC1 in Tumor Cell Recruitment to Vascular Endothelium during Physiological Fluid Flow. M.Sc. thesis, University of Alberta, Edmonton, Alberta, CanadaGoogle Scholar), that the MUC1/ICAM-1 interaction be involved in facilitating the extravasation of blood of the Our current that the MUC1/ICAM-1 interaction can an intracellular oscillatory calcium-based signal in epithelial cells, an that MCF-7 cells were or in The MUC1/ICAM-1 oscillatory calcium signal appears to from the previously MUC1 cytoplasmic domain (2Wang H. Lillehoj E.P. Kim K.C. Biochem. Biophys. Res. Commun. 2003; 310: 341-346Crossref PubMed Scopus (51) Google Scholar, 4Quin R.J. McGuckin M.A. Int. J. Cancer. 2000; 87: 499-506Crossref PubMed Scopus (65) Google Scholar, Y. Kuwahara H. Ren J. Wen G. Kufe D. J. Biol. Chem. 2001; 276: 6061-6064Abstract Full Text Full Text PDF PubMed Scopus (205) Google Scholar, 6Li Y. Bharti A. Chen D. Gong J. Kufe D. Mol. Cell. Biol. 1998; 18: 7216-7224Crossref PubMed Scopus (222) Google Scholar, 8Pandey P. Kharbanda S. Kufe D. Cancer Res. 1995; 55: 4000-4003PubMed Google Scholar, J.A. Thompson M.C. Gardner M.M. Gendler S.J. J. Biol. Chem. 2001; 276: 13057-13064Abstract Full Text Full Text PDF PubMed Scopus (289) Google Scholar, 10Schroeder J.A. Adriance M.C. Thompson M.C. Camenisch T.D. Gendler S.J. Oncogene. 2003; 22: 1324-1332Crossref PubMed Scopus (149) Google Scholar, D. Shapiro P.S. Kim K.C. Am. J. Physiol. 2001; 281: L86-L91PubMed Google Scholar, J. Li Y. Kufe D. J. Biol. Chem. 2002; Full Text Full Text PDF PubMed Scopus Google Scholar, Y. Ren J. Li Kuwahara H. L. Kufe D. J. Biol. Chem. 2001; 276: Full Text Full Text PDF PubMed Scopus Google Scholar), it is not on the (Fig. (9Schroeder J.A. Thompson M.C. Gardner M.M. Gendler S.J. J. Biol. Chem. 2001; 276: 13057-13064Abstract Full Text Full Text PDF PubMed Scopus (289) Google Scholar) reported that the is by after stimulation with with activation of the pathway. This activation was not associated with as by cell activation (9Schroeder J.A. Thompson M.C. Gardner M.M. Gendler S.J. J. Biol. Chem. 2001; 276: 13057-13064Abstract Full Text Full Text PDF PubMed Scopus (289) Google Scholar). In the has implicated the in the of and through a J.A. Adriance M.C. Thompson M.C. Camenisch T.D. Gendler S.J. Oncogene. 2003; 22: 1324-1332Crossref PubMed Scopus (149) Google Scholar). activation of has also been implicated in (16Feldner J.C. Brandt B.H. Exp. Cell Res. 2002; 272: 93-108Crossref PubMed Scopus (86) Google Scholar), the MUC1/ICAM-1 calcium signal may in with is that we are using ICAM-1 to calcium it is a MUC1 and the oscillatory response is of a as the and amplitude of calcium oscillations to 1998; PubMed Scopus Google Scholar). of this signal may include M. M. J. Biol. Chem. Full Text Full Text PDF PubMed Scopus Google Scholar), A. Int. J. Biochem. Cell Biol. 2002; PubMed Scopus Google Scholar), and H. P. S. 2002; PubMed Scopus Google Scholar), which are involved in cytoskeletal adhesion and cell Our of a of that this signal is through the phospholipase Cell. 2002; Full Text Full Text PDF PubMed Scopus Google Scholar), and which may MUC1 with calcium signal as Src with MUC1 (5Li Y. Kuwahara H. Ren J. Wen G. Kufe D. J. Biol. Chem. 2001; 276: 6061-6064Abstract Full Text Full Text PDF PubMed Scopus (205) Google Scholar) and can be of and C. J.L. Mol. 2002; PubMed Scopus Google Scholar, Y. Cell 2002; PubMed Scopus Google Scholar, L. J.A. J. Biol. Chem. 2003; 278: Full Text Full Text PDF PubMed Scopus Google Scholar). The data the of this signal on lipid is as has previously been to the of Src Kim Kim T.D. Kim J. Biol. Chem. Full Text Full Text PDF PubMed Scopus Google Scholar) and S. C. A. 2003; PubMed Scopus Google Scholar, Y. G. M.A. J. 2003; PubMed Scopus Google Scholar). the evidence that the MUC1/ICAM-1 interaction in a calcium-based promigratory the of of Dr. Sandra Gendler and Dr. Ken for and cells with for in fluorescent and in flow for for of the Dr. for and and Dr. and Dr. for and in using the Metamorph software with

Récupéré en direct depuis OpenAlex et désinversé. Les résumés ne sont pas conservés dans cette base de données : les index inversés représentent 8,6 Go des 9,3 Go de texte de la base, et le serveur dispose de 13 Go libres.