Determination of lipoprotein(a) kringle repeat number from genomic DNA: copy number variation genotyping using qPCR

Plasma lipoprotein(a) [Lp(a)] concentration is related to risk of cardiovascular disease. The defining protein component of Lp(a) particles, apolipoprotein(a) [apo(a)], is encoded by the LPA gene. Apo(a) is extremely heterogeneous in size due to a common copy number variation, leading to a variable number of kringle-IV type 2 (KIV2)-like domains. Alleles with fewer KIV2 repeats, encoding smaller apo(a) isoforms, are associated with higher plasma Lp(a) concentrations. Two principal methods to detect variation in KIV2 repeat number are electrophoresis with immunoblotting to detect apo(a) protein isoforms or pulse-field electrophoresis of unamplified genomic DNA to detect the variation of the LPA gene. Both methods are technically challenging, laborious, and time consuming. Here, we report a rapid method to determine the number of KIV2 repeats in LPA from genomic DNA using quantitative real-time polymerase chain reaction (qPCR). With qPCR, we found KIV2 repeat number was correlated with both apo(a) isoform size as determined by immunoblotting (rs = 0.50, P < 1 × 10−6) and with plasma Lp(a) concentration (rs = 0.30, P < 1 × 10−6). The qPCR technique permits rapid evaluation of apo(a) size from genomic DNA, and thus would provide an adjunctive genomic variable, in addition to LPA single nucleotide polymorphisms, for evaluating the genetic determinants of plasma Lp(a) concentration in genetic epidemiology studies of cardiovascular disease outcomes. Plasma lipoprotein(a) [Lp(a)] concentration is related to risk of cardiovascular disease. The defining protein component of Lp(a) particles, apolipoprotein(a) [apo(a)], is encoded by the LPA gene. Apo(a) is extremely heterogeneous in size due to a common copy number variation, leading to a variable number of kringle-IV type 2 (KIV2)-like domains. Alleles with fewer KIV2 repeats, encoding smaller apo(a) isoforms, are associated with higher plasma Lp(a) concentrations. Two principal methods to detect variation in KIV2 repeat number are electrophoresis with immunoblotting to detect apo(a) protein isoforms or pulse-field electrophoresis of unamplified genomic DNA to detect the variation of the LPA gene. Both methods are technically challenging, laborious, and time consuming. Here, we report a rapid method to determine the number of KIV2 repeats in LPA from genomic DNA using quantitative real-time polymerase chain reaction (qPCR). With qPCR, we found KIV2 repeat number was correlated with both apo(a) isoform size as determined by immunoblotting (rs = 0.50, P < 1 × 10−6) and with plasma Lp(a) concentration (rs = 0.30, P < 1 × 10−6). The qPCR technique permits rapid evaluation of apo(a) size from genomic DNA, and thus would provide an adjunctive genomic variable, in addition to LPA single nucleotide polymorphisms, for evaluating the genetic determinants of plasma Lp(a) concentration in genetic epidemiology studies of cardiovascular disease outcomes. Elevated plasma concentrations of lipoprotein(a) [Lp(a)] have been associated with risk of myocardial infarction and ischemic stroke (1Ridker P.M. Hennekens C.H. Stampfer M.J. A prospective study of lipoprotein(a) and the risk of myocardial infarction.JAMA. 1993; 270: 2195-2199Crossref PubMed Scopus (460) Google Scholar, 2Rhoads G.G. Dahlen G. Berg K. Morton N.E. Dannenberg A.L. Lp(a) lipoprotein as a risk factor for myocardial infarction.JAMA. 1986; 256: 2540-2544Crossref PubMed Scopus (665) Google Scholar, 3Ohira T. Schreiner P.J. Morrisett J.D. Chambless L.E. Rosamond W.D. Folsom A.R. Lipoprotein(a) and incident ischemic stroke: the Atherosclerosis Risk in Communities (ARIC) study.Stroke. 2006; 37: 1407-1412Crossref PubMed Scopus (90) Google Scholar, 4Moliterno D.J. Jokinen E.V. Miserez A.R. Lange R.A. Willard J.E. Boerwinkle E. Hillis L.D. Hobbs H.H. No association between plasma lipoprotein(a) concentrations and the presence or absence of coronary atherosclerosis in African-Americans.Arterioscler. Thromb. Vasc. Biol. 1995; 15: 850-855Crossref PubMed Scopus (110) Google Scholar–5Rosengren A. Wilhelmsen L. Eriksson E. Risberg B. Wedel H. Lipoprotein (a) and coronary heart disease: a prospective case-control study in a general population sample of middle aged men.BMJ. 1990; 301: 1248-1251Crossref PubMed Scopus (507) Google Scholar). An interesting paradox is the apparent lack of association in African Americans (4Moliterno D.J. Jokinen E.V. Miserez A.R. Lange R.A. Willard J.E. Boerwinkle E. Hillis L.D. Hobbs H.H. No association between plasma lipoprotein(a) concentrations and the presence or absence of coronary atherosclerosis in African-Americans.Arterioscler. Thromb. Vasc. Biol. 1995; 15: 850-855Crossref PubMed Scopus (110) Google Scholar), despite higher mean levels of Lp(a) than Caucasians (6Sorrentino M.J. Vielhauer C. Eisenbart J.D. Fless G.M. Scanu A.M. Feldman T. Plasma lipoprotein (a) protein concentration and coronary artery disease in black patients compared with white patients.Am. J. Med. 1992; 93: 658-662Abstract Full Text PDF PubMed Scopus (54) Google Scholar). Myocardial infarction and stroke are the result of not only atherogenicity, or plaque formation, but also of thromboembolic events resulting from plaque rupture (7Hegele R.A. The genetic basis of atherosclerosis.Int. J. Clin. Lab. Res. 1997; 27: 2-13Crossref PubMed Scopus (31) Google Scholar). Lp(a) is unique in its potential to be involved via either one or both of these pathways. Lp(a) could interfere with plasminogen activation (8Lawn R.M. Schwartz K. Patthy L. Convergent evolution of apolipoprotein(a) in primates and hedgehog.Proc. Natl. Acad. Sci. USA. 1997; 94: 11992-11997Crossref PubMed Scopus (63) Google Scholar) or platelet function (9Martinez C. Rivera J. Loyau S. Corral J. Gonzalez-Conejero R. Lozano M.L. Vicente V. Angles-Cano E. Binding of recombinant apolipoprotein(a) to human platelets and effect on platelet aggregation.Thromb. Haemost. 2001; 85: 686-693Crossref PubMed Scopus (34) Google Scholar), or it could contribute to inflammation (10Syrovets T. Thillet J. Chapman M.J. Simmet T. Lipoprotein(a) is a potent chemoattractant for human peripheral monocytes.Blood. 1997; 90: 2027-2036Crossref PubMed Google Scholar) or endothelial dysfunction (11Schlaich M.P. John S. Langenfeld M.R. Lackner K.J. Schmitz G. Schmieder R.E. Does lipoprotein(a) impair endothelial function?.J. Am. Coll. Cardiol. 1998; 31: 359-365Crossref PubMed Scopus (66) Google Scholar). Nevertheless, the lack of association in some populations has led to controversy regarding the use of Lp(a) as a marker of risk in common clinical practice. Plasma levels of Lp(a) range over 1,000-fold between individuals, yet the plasma Lp(a) in a particular individual remains stable over a lifetime (12Albers J.J. Hazzard W.R. Immunochemical quantification of human plasma Lp(a) lipoprotein.Lipids. 1974; 9: 15-26Crossref PubMed Scopus (160) Google Scholar). Lp(a) is composed of an apolipoprotein(a) [apo(a)] molecule connected via a disulfide bond to the apolipoprotein B-100 of a proatherogenic LDL cholesterol particle (13Berglund L. Ramakrishnan R. Lipoprotein(a): an elusive cardiovascular risk factor.Arterioscler. Thromb. Vasc. Biol. 2004; 24: 2219-2226Crossref PubMed Scopus (192) Google Scholar). The interindividual variation in Lp(a) levels is 90% genetically determined by the LPA locus, a large gene found on chromosome 6 (132 kb in reference sequence NC_000006.10 build 36.3; 6q27; MIM: 152200) (14Boerwinkle E. Leffert C.C. Lin J. Lackner C. Chiesa G. Hobbs H.H. Apolipoprotein(a) gene accounts for greater than 90% of the variation in plasma lipoprotein(a) concentrations.J. Clin. Invest. 1992; 90: 52-60Crossref PubMed Scopus (812) Google Scholar). Apo(a) is the large protein encoded by LPA, and is composed of a signal peptide region, many repeating kringle domains, and a protease domain (13Berglund L. Ramakrishnan R. Lipoprotein(a): an elusive cardiovascular risk factor.Arterioscler. Thromb. Vasc. Biol. 2004; 24: 2219-2226Crossref PubMed Scopus (192) Google Scholar). LPA contains 10 types of kringles that differ in sequence but are homologous with plasminogen kringle IV (KIV1–10), as well as a kringle homologous to plasminogen kringle V (KV) (Fig. 1) (13Berglund L. Ramakrishnan R. Lipoprotein(a): an elusive cardiovascular risk factor.Arterioscler. Thromb. Vasc. Biol. 2004; 24: 2219-2226Crossref PubMed Scopus (192) Google Scholar). Moreover, apo(a) has a variable number of repeats of one type of kringle domain, kringle-IV type 2 (KIV2), the result of genomic duplication and deletion of the two exons that encode for the KIV2 kringle (∼5 kb in size at the genomic DNA level) (13Berglund L. Ramakrishnan R. Lipoprotein(a): an elusive cardiovascular risk factor.Arterioscler. Thromb. Vasc. Biol. 2004; 24: 2219-2226Crossref PubMed Scopus (192) Google Scholar). The repeating KIV2 domains are an example of a common and functional copy number variation. The National Centre for Biotechnology Information reference sequence (reference#: NC_000006.10 build 36.3) contains 6 repeats of the kringle KIV2 domain, but the number of KIV2 repeats ranges from 5 to >50 in human populations (15Kraft H.G. Kochl S. Menzel H.J. Sandholzer C. Utermann G. The apolipoprotein (a) gene: a transcribed hypervariable locus controlling plasma lipoprotein (a) concentration.Hum. Genet. 1992; 90: 220-230Crossref PubMed Scopus (227) Google Scholar). The genetically determined KIV2 repeat size affects the final size of the apo(a) protein, with larger isoforms being compromised with respect to protein folding, transport, and secretion. Null alleles have been identified, in which one allele has an exceedingly large number of KIV2 repeats and does not produce a secreted protein (16Gaw A. Boerwinkle E. Cohen J.C. Hobbs H.H. Comparative analysis of the apo(a) gene, apo(a) glycoprotein, and plasma concentrations of Lp(a) in three ethnic groups. Evidence for no common “null” allele at the apo(a) locus.J. Clin. Invest. 1994; 93: 2526-2534Crossref PubMed Google Scholar). Thus, the number of apo(a) KIV2 repeats is inversely proportional to plasma Lp(a) levels, determining between 20–40% of the variation in Lp(a) levels (17Boerwinkle E. Menzel H.J. Kraft H.G. Utermann G. Genetics of the quantitative Lp(a) lipoprotein trait. III. Contribution of Lp(a) glycoprotein phenotypes to normal lipid variation.Hum. Genet. 1989; 82: 73-78Crossref PubMed Scopus (178) Google Scholar, 18Hegele R.A. Breckenridge W.C. Brunt J.H. Connelly P.W. Genetic variation in factor VII associated with variation in plasma lipoprotein(a) concentration.Arterioscler. Thromb. Vasc. Biol. 1997; 17: 1701-1706Crossref PubMed Scopus (17) Google Scholar). The biochemical effect of the kringle repeat number on the function of circulating Lp(a) is unknown. Many studies have identified increased atherogenesis and coronary artery disease risk in individuals with fewer apo(a) KIV2 repeats (19Paultre F. Pearson T.A. Weil H.F. Tuck C.H. Myerson M. Rubin J. Francis C.K. Marx H.F. Philbin E.F. Reed R.G. et al.High levels of Lp(a) with a small apo(a) isoform are associated with coronary artery disease in African American and white men.Arterioscler. Thromb. Vasc. Biol. 2000; 20: 2619-2624Crossref PubMed Scopus (151) Google Scholar, 20Kraft H.G. Lingenhel A. Kochl S. Hoppichler F. Kronenberg F. Abe A. Muhlberger V. Schonitzer D. Utermann G. Apolipoprotein(a) kringle IV repeat number predicts risk for coronary heart disease.Arterioscler. Thromb. Vasc. Biol. 1996; 16: 713-719Crossref PubMed Scopus (207) Google Scholar–21Sandholzer C. Saha N. Kark J.D. Rees A. Jaross W. Dieplinger H. Hoppichler F. Boerwinkle E. Utermann G. Apo(a) isoforms predict risk for coronary heart disease. A study in six populations.Arterioscler. Thromb. 1992; 12: 1214-1226Crossref PubMed Scopus (315) Google Scholar). Regardless, many current studies attempting to find either genetic associations with Lp(a) levels or associations between Lp(a) levels and disease endpoints are reported without KIV2 repeat identification (22Scanu A.M. Lp(a) lipoprotein–coping with heterogeneity.N. Engl. J. Med. 2003; 349: 2089-2090Crossref PubMed Scopus (39) Google Scholar). The large size of the genomic repeat (∼5 kb) precludes repeat number identification using standard sequencing or genotyping techniques. Current methods used to identify the number of KIV2 repeats examine either the apo(a) protein size using electrophoresis with immunoblotting (15Kraft H.G. Kochl S. Menzel H.J. Sandholzer C. Utermann G. The apolipoprotein (a) gene: a transcribed hypervariable locus controlling plasma lipoprotein (a) concentration.Hum. Genet. 1992; 90: 220-230Crossref PubMed Scopus (227) Google Scholar), or the number of tandem repeats using pulse-field electrophoresis of genomic DNA (23Angles-Cano E. Loyau S. Cardoso-Saldana G. Couderc R. Gillery P. A novel kringle-4 number-based recombinant apo[a] standard for human apo[a] phenotyping.J. Lipid Res. 1999; 40: 354-359Abstract Full Text Full Text PDF PubMed Google Scholar). Both of these techniques are time and labor intensive and require a high degree of technical skill. Quantitative real-time polymerase chain reaction (qPCR) has been used to verify the number of synthetic gene constructs successfully integrated into a plant genome after transformation (24Bubner B. Baldwin I.T. Use of real-time PCR for determining copy number and zygosity in transgenic plants.Plant Cell Rep. 2004; 23: 263-271Crossref PubMed Scopus (183) Google Scholar). Similarly, qPCR has been used to verify copy number variations in humans (25Wu Y.L. Savelli S.L. Yang Y. Zhou B. Rovin B.H. Birmingham D.J. Nagaraja H.N. Hebert L.A. Yu C.Y. Sensitive and specific real-time polymerase chain reaction assays to accurately determine copy number variations (CNVs) of human complement C4A, C4B, C4-long, C4-short, and RCCX modules: elucidation of C4 CNVs in 50 consanguineous subjects with defined HLA genotypes.J. Immunol. 2007; 179: 3012-3025Crossref PubMed Scopus (69) Google Scholar). Thus, we hypothesized that qPCR could be used quickly and accurately to identify the number of KIV2 repeats in LPA from genomic DNA. Two hundred fifty-seven Alberta Hutterites were included in the study as previously described (18Hegele R.A. Breckenridge W.C. Brunt J.H. Connelly P.W. Genetic variation in factor VII associated with variation in plasma lipoprotein(a) concentration.Arterioscler. Thromb. Vasc. Biol. 1997; 17: 1701-1706Crossref PubMed Scopus (17) Google Scholar). The study was approved by ethical review panels of the Universities of Alberta and Toronto. Blood was collected after a 12- to 14-h fasting period, and plasma Lp(a) concentrations were determined using a sandwich enzyme-linked immunoadsorbent assay using monoclonal antibodies 3A5 and 5C4 as previously described (18Hegele R.A. Breckenridge W.C. Brunt J.H. Connelly P.W. Genetic variation in factor VII associated with variation in plasma lipoprotein(a) concentration.Arterioscler. Thromb. Vasc. Biol. 1997; 17: 1701-1706Crossref PubMed Scopus (17) Google Scholar). Apo(a) isoforms had been previously identified by resolving total plasma protein by 4% PAGE in the presence of SDS, followed by a sensitive chemiluminescent immunoblotting system (18Hegele R.A. Breckenridge W.C. Brunt J.H. Connelly P.W. Genetic variation in factor VII associated with variation in plasma lipoprotein(a) concentration.Arterioscler. Thromb. Vasc. Biol. 1997; 17: 1701-1706Crossref PubMed Scopus (17) Google Scholar). Alleles were then separated into 16 groups by apo(a) size (18Hegele R.A. Breckenridge W.C. Brunt J.H. Connelly P.W. Genetic variation in factor VII associated with variation in plasma lipoprotein(a) concentration.Arterioscler. Thromb. Vasc. Biol. 1997; 17: 1701-1706Crossref PubMed Scopus (17) Google Scholar). Genomic DNA was extracted from peripheral leukocytes using established protocols. A multiplexed qPCR was carried out using TaqMan® probes for LPA KIV2 and an endogenous single-copy control gene in the Applied Biosystems 7900HT Fast Real-Time PCR system. Custom TaqMan® gene expression LPA probes in exons 4 and 5 were designed using Applied Biosystems FileBuilder 3.1 (sequences are given in Table 1). TaqMan® RNase P (RNAP) control reagent was used as single-copy reference gene (Part Number 4316844). Reaction volumes contained: 5 uL of water, 1.25 uL of 20× TaqMan® primer/probe mix for LPA, 1.25 uL of 20× TaqMan® primer/probe mix for RNAP, 12.5 uL of 2× gene expression GX master mix (Applied Biosystems), and 4 uL of genomic DNA at a concentration of 5–7 ng/ul. Thermocycler conditions were as follows: 95°C hot-start for 10 min, followed by 40 cycles of 95°C for 15 s, 60°C for 1 min.TABLE 1Primer and probe sequences for Taqman reactionsTargetPrimer and Probe SequencesLPA Exon 4Forward primer: GTCAGGTGGGAGTACTGCAAReverse primer: CGACGGCAGTCCCTTCTGProbe: CCTGACGCAATGCTCALPA Exon 5Forward primer: GCACATACTCCACCACTGTCAReverse primer: GCGAGTGTGGTGTCATAGATGAProbe: CTTGGCAGGTTCTTCC Open table in a new tab The total number of LPA KIV2 repeats as determined by immunoblotting was calculated by adding the predicted size of the two alleles if visualized, or doubling the allele count if only a single spot was observed. Cycle thresholds (CT) were identified using the relative quantification manager software (Applied Biosystems). The repeat number as determined by qPCR was calculated by determining the difference in CT between multiplexed target and control probes (ΔCT). The ΔCT was calculated for both the exon 4 (ΔCT4) and exon 5 (ΔCT5) probes for all individuals. The average difference between ΔCT4 and ΔCT5 (ΔΔCT) was calculated for all samples, and individuals whose ΔΔCT was greater than two standard deviations from the mean were excluded from the analysis. The average of ΔCT4 and ΔCT5 ( ΔCT¯) was then used for further analysis as the relative kringle repeat number. Finally, the nonparametric Spearman Rank Order Correlation (rs) was calculated in SAS (v9.1) to identify the correlation between ΔCT4 and ΔCT5, the correlation between the previously identified Lp(a) protein isoform size and relative KIV2 kringle repeat number, and the correlation between the plasma Lp(a) concentrations and relative KIV2 kringle repeat number. Lower ΔCT values were observed for LPA probes than RNAP probes, as one would expect given the greater amounts of LPA repeat DNA than the single-copy RNAP DNA. ΔCT¯ values ranged from 2.5 to 6.2 cycles faster for the LPA probe than the RNAP probe. The difference between ΔCT4 and ΔCT5 was greater than 2 standard deviations for eight individuals, who were excluded from subsequent analysis. A strong correlation was found between the probes targeted to exons four and five, which are located in the KIV2 repeat (rs = 0.85, P < 1 × 10−6; Fig. 2). A positive correlation between ΔCT¯ and Lp(a) isoform size identified by PAGE and immunoblotting was identified (rs = 0.50, P < 1 × 10−6; Fig. 3). An inverse relationship between ΔCT¯ and the square root of plasma Lp(a) concentration was also observed (rs = 0.30, P < 1 × 10−6; Fig. 4). The correlation between the square root of plasma Lp(a) concentration and Lp(a) isoform size as identified by PAGE and immunoblotting (rs = 0.19, P = 0.0054) was weaker than the relationship observed using qPCR.Fig. 3The relationship between apolipoprotein(a) [apo(a)] isoform as identified by PAGE and immunoblotting and ΔCT¯ from quantitative real-time polymerase chain reaction (qPCR).View Large Image Figure ViewerDownload Hi-res relationship between plasma of lipoprotein(a) [Lp(a)] concentration and ΔCT¯ from Large Image Figure ViewerDownload Hi-res that the relative number of KIV2 repeats be identified by the relative of LPA target DNA compared with RNAP reference DNA using multiplexed real-time qPCR of genomic DNA. The ΔCT¯ was correlated with Lp(a) isoform size as determined by PAGE and immunoblotting (rs = 0.50, P < 1 × 10−6). the ΔCT¯ was correlated with plasma Lp(a) concentration in a sample of Alberta Hutterites (rs = 0.30, P < 1 × 10−6). The association between KIV2 repeat number using immunoblotting and Lp(a) concentration was to that reported in the H. Morrisett J.D. between lipoprotein(a) levels, apo(a) isoforms and of in PubMed Scopus Google Scholar). Lp(a) concentration was correlated with the ΔCT¯ of qPCR than it was with has been that Lp(a) concentrations are associated with the genetic variation in the LPA locus on chromosome 6 R.A. M. R.M. Genetic between lipoprotein(a) and a DNA in the plasminogen PubMed Scopus Google Scholar). as in Fig. strong the kringle of Thus, the a in the LPA locus is associated with plasma Lp(a) concentration could be between the and the number of KIV2 could be using qPCR The of genotyping or have been copy number techniques have been on 4 and of as in the LPA locus have not been qPCR method be as an adjunctive technique for the genetic variation in the LPA potential of CT values between primer/probe is the of variation in primer/probe between individuals in than relative in the of target DNA. the of primer/probe exon sequence no were for and probe primer/probe were targeted to both of the exons KIV2 and in a correlation would be observed between the two a strong correlation was observed between the two probes (rs = 0.85, P < 1 × 10−6) and eight individuals were from the study due to between the probes 2 standard An was that qPCR would not be sensitive to between alleles that by a single repeat 10 of the no were we the ΔCT¯ of attempting to ΔCT¯ into copy number An of the qPCR technique is that it the total number of KIV2 repeats, not the number of KIV2 repeats in an allele specific An individual with 10 KIV2 repeats from and KIV2 repeats from could have a biochemical than an individual who 15 KIV2 repeats from both qPCR would not be to between these two individuals. An individual who a Lp(a) would to be for the allele using but the qPCR would identify the as a large number of KIV2 The individual in the of Fig. could be an individual ( ΔCT¯ = one spot of size was on the are by the that real-time qPCR a and method of the relative total number of KIV2 repeats from genomic DNA that have been Thus, apo(a) KIV2 repeat size by qPCR is a new assay that could be used in to of plasma Lp(a) studies genetic association with either plasma Lp(a) concentration or cardiovascular disease endpoints of the apo(a) KIV2 repeat in addition to the that have been used to study the locus at the genomic DNA Breckenridge the apo(a) is a of the and of and the in Genetics and the J.

Récupéré en direct depuis OpenAlex et désinversé. Les résumés ne sont pas conservés dans cette base de données : les index inversés représentent 8,6 Go des 9,3 Go de texte de la base, et le serveur dispose de 13 Go libres.