MétaCan
Menu
Retour à la cohorte
Enregistrement W2092395757 · doi:10.1074/jbc.m507607200

Nutritional Status, Cognition, and Survival

2005· article· en· W2092395757 sur OpenAlexaboutno aff
Yossi Dagon, Yosefa Avraham, Iddo Magen, A. Gertler, Tamir Ben‐Hur, Elliot M. Berry

Notice bibliographique

RevueJournal of Biological Chemistry · 2005
Typearticle
Langueen
DomaineNeuroscience
ThématiqueRegulation of Appetite and Obesity
Établissements canadiensnon disponible
Organismes subventionnairesnon disponible
Mots-clésAMPKLeptinNeurogenesisProtein kinase AAdiponectinAMP-activated protein kinaseEndocrinologyInternal medicineCognitive declineMedicineCognitionBiologyNeuroscienceDementiaKinaseCell biologyDiabetes mellitusObesityInsulin resistance

Résumé

récupéré en direct d'OpenAlex

Although adequate nutrition is essential for optimal neural activity and survival, mild energy restriction may improve cognition and prolong longevity. Energy status is monitored by the cellular AMP-activated protein kinase (AMPK) system, whereas leptin regulates total energy balance. We investigated the roles of AMPK and leptin in cognition and survival under diet restriction (DR). Hippocampal AMPK activity increases with energy restriction. Modest activation (DR to 60%) induces neurogenesis and improves cognition. However, DR to 40% augmented AMPK activity, reduced cognition and catecholamines, and increased neural apoptosis and mortality. Leptin signaling is preserved only in DR to 60%, countering the effects of AMPK “overactivation” by preventing neuroapoptosis, restoring noradrenergic activity and behavioral performance, and increasing longevity. The balance between leptin and AMPK is crucial in determining neuronal fate, cognitive ability, and survival. Should these findings extend to Man, then controlled activation of AMPK may improve neurodegenerative diseases, and leptin may have a new role in treating stress-associated malnutrition. Although adequate nutrition is essential for optimal neural activity and survival, mild energy restriction may improve cognition and prolong longevity. Energy status is monitored by the cellular AMP-activated protein kinase (AMPK) system, whereas leptin regulates total energy balance. We investigated the roles of AMPK and leptin in cognition and survival under diet restriction (DR). Hippocampal AMPK activity increases with energy restriction. Modest activation (DR to 60%) induces neurogenesis and improves cognition. However, DR to 40% augmented AMPK activity, reduced cognition and catecholamines, and increased neural apoptosis and mortality. Leptin signaling is preserved only in DR to 60%, countering the effects of AMPK “overactivation” by preventing neuroapoptosis, restoring noradrenergic activity and behavioral performance, and increasing longevity. The balance between leptin and AMPK is crucial in determining neuronal fate, cognitive ability, and survival. Should these findings extend to Man, then controlled activation of AMPK may improve neurodegenerative diseases, and leptin may have a new role in treating stress-associated malnutrition. Since the Garden of Eden and the trees of knowledge and life, the connection between food, cognition, and survival has been recognized. Today, nutritional status is a well accepted regulator of neural function and longevity. Studies have shown that mild energy restriction (to 60% of control) improves cognitive function, whereas severe restriction (to 40%) prejudices it (1Pitsikas N. Algeri S. Neurobiol. Aging. 1992; 13: 369-373Crossref PubMed Scopus (121) Google Scholar, 2Avraham Y. Bonne O. Berry E.M. Brain Res. 1996; 732: 133-144Crossref PubMed Scopus (50) Google Scholar). Such cognitive dysfunction may manifest as deficits in hippocampal-dependent learning and memory, including spatial information processing (3Petit T.L. Neurotoxicology. 1988; 9: 413-428PubMed Google Scholar). The benefits of mild energy restriction have been repeatedly demonstrated in prolonging longevity (4McCay C.M. Crowell M.F. Maynard L.A. J. Nutr. 1935; 10: 63-79Crossref Google Scholar, 5Fernandes G. Yunis E.J. Good R.A. Proc. Natl. Acad. Sci. U. S. A. 1976; 73: 1279-1283Crossref PubMed Scopus (186) Google Scholar) and in improving neurodegenerative diseases (6Duan W. Mattson M.P. J. Neurosci. Res. 1999; 57: 195-206Crossref PubMed Scopus (396) Google Scholar, 7Love R. Lancet Neurol. 2005; 4: 84Abstract Full Text Full Text PDF PubMed Scopus (20) Google Scholar). Understanding of the mechanisms for neural damage advanced when apoptosis was shown to be responsible for some of the neural cell loss found in Parkinson and in Alzheimer disease (8Gervais F.G. Xu D. Robertson G.S. Vaillancourt J.P. Zhu Y. Huang J. LeBlanc A. Smith D. Rigby M. Shearman M.S. Clarke E.E. Zheng H. Van Der Ploeg L.H. Ruffolo S.C. Thornberry N.A. Xanthoudakis S. Zamboni R.J. Roy S. Nicholson D.W. Cell. 1999; 97: 395-406Abstract Full Text Full Text PDF PubMed Scopus (713) Google Scholar, 9Hartmann A. Hunot S. Michel P.P. Muriel M.P. Vyas S. Faucheux B.A. Mouatt-Prigent A. Turmel H. Srinivasan A. Ruberg M. Evan G.I. Agid Y. Hirsch E.C. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 2875-2880Crossref PubMed Scopus (616) Google Scholar). Neuroapoptotic cell death is a multistep process involving several key molecules, modulation of which may inhibit the process. Such neuroprotective agents were also found to overcome poor behavioral performance found in animal models for these diseases (10During M.J. Cao L. Zuzga D.S. Francis J.S. Fitzsimons H.L. Jiao X. Bland R.J. Klugmann M. Banks W.A. Drucker D.J. Haile C.N. Nat. Med. 2003; 9: 1173-1179Crossref PubMed Scopus (649) Google Scholar, 11Maruyama W. Weinstock M. Youdim M.B. Nagai M. Naoi M. Neurosci. Lett. 2003; 341: 233-236Crossref PubMed Scopus (95) Google Scholar). The mammalian forebrain contains populations of cells that divide and differentiate into neurons and glia (12Gage F.H. Science. 2000; 287: 1433-1438Crossref PubMed Scopus (4077) Google Scholar). These neurons are generated continuously from stem cells in specific regions of the adult brain (13McKay R. Science. 1997; 276: 66-71Crossref PubMed Scopus (1331) Google Scholar). Such constitutive neurogenesis can be modulated by changes in diet. Reduced nutritional status in mice increased the numbers of newly generated cells primarily in the dentate gyrus of the hippocampus (14Cameron H.A. McKay R.D. J. Comp. Neurol. 2001; 435: 406-417Crossref PubMed Scopus (1321) Google Scholar, 15Lee J. Seroogy K.B. Mattson M.P. J. Neurochem. 2002; 80: 539-547Crossref PubMed Scopus (375) Google Scholar), which is the principal center for learning and memory (16Turner E. Lancet. 1969; 2: 1123-1126Abstract PubMed Google Scholar); suppression of neurogenesis led to impaired learning and memory (17Shors T.J. Miesegaes G. Beylin A. Zhao M. Rydel T. Gould E. Nature. 2001; 410: 372-376Crossref PubMed Scopus (1718) Google Scholar). Cellular energy status is monitored and controlled by the 5′-AMP-activated protein kinase (AMPK) 2The abbreviations used are: AMPKAMP-activated protein kinaseALad libitumDRdiet restrictionHPLChigh performance liquid chromatographyAICAR5-aminoimidazole-4-carboxamide ribonucleoside.2The abbreviations used are: AMPKAMP-activated protein kinaseALad libitumDRdiet restrictionHPLChigh performance liquid chromatographyAICAR5-aminoimidazole-4-carboxamide ribonucleoside. system. AMPK is allosterically activated by 5′-AMP, which accumulates following ATP hydrolysis (18Hardie D.G. J. Cell Sci. 2004; 117: 5479-5487Crossref PubMed Scopus (960) Google Scholar, 19Hardie D.G. Carling D. Eur. J. Biochem. 1997; 246: 259-273Crossref PubMed Scopus (1138) Google Scholar). Recent studies have demonstrated that this activation regulates intracellular signaling pathways involved in cellular survival and apoptotic cell death (20Campas C. Lopez J.M. Santidrian A.F. Barragan M. Bellosillo B. Colomer D. Gil J. Blood. 2003; 101: 3674-3680Crossref PubMed Scopus (119) Google Scholar, 21Meisse D. Van de Casteele M. Beauloye C. Hainault I. Kefas B.A. Rider M.H. Foufelle F. Hue L. FEBS Lett. 2002; 526: 38-42Crossref PubMed Scopus (179) Google Scholar, 22Ido Y. Carling D. Ruderman N. Diabetes. 2002; 51: 159-167Crossref PubMed Scopus (296) Google Scholar). AMPK is considered to act as a “fuel gauge” for cellular metabolism (18Hardie D.G. J. Cell Sci. 2004; 117: 5479-5487Crossref PubMed Scopus (960) Google Scholar), controlling the endogenous energy supply of ATP. It was therefore not surprising when AMPK was also found to regulate feeding behavior (23Andersson U. Filipsson K. Abbott C.R. Woods A. Smith K. Bloom S.R. Carling D. Small C.J. J. Biol. Chem. 2004; 279: 12005-12008Abstract Full Text Full Text PDF PubMed Scopus (639) Google Scholar, 24Minokoshi Y. Alquier T. Furukawa N. Kim Y.B. Lee A. Xue B. Mu J. Foufelle F. Ferre P. Birnbaum M.J. Nature. 2004; 428: 569-574Crossref PubMed Scopus (1332) Google Scholar). AMP-activated protein kinase ad libitum diet restriction high performance liquid chromatography 5-aminoimidazole-4-carboxamide ribonucleoside. AMP-activated protein kinase ad libitum diet restriction high performance liquid chromatography 5-aminoimidazole-4-carboxamide ribonucleoside. Leptin is an adipokinin hormone that plays a central role in food intake and energy balance, mainly through its hypothalamic receptors (25Lee G.H. Proenca R. Montez J.M. Carroll K.M. Darvishzadeh J.G. Lee J.I. Friedman J.M. Nature. 1996; 379: 632-635Crossref PubMed Scopus (2108) Google Scholar, 26Chua Jr., S.C. Chung W.K. Wu-Peng X.S. Zhang Y. Liu S.M. Tartaglia L. Leibel R.L. Science. 1996; 271: 994-996Crossref PubMed Scopus (1033) Google Scholar, 27Montague C.T. Farooqi I.S. Whitehead J.P. Soos M.A. Rau H. Wareham N.J. Sewter C.P. Digby J.E. Mohammed S.N. Hurst J.A. Cheetham C.H. Earley A.R. Barnett A.H. Prins J.B. O'Rahilly S. Nature. 1997; 387: 903-908Crossref PubMed Scopus (2440) Google Scholar). Studies on leptin function have demonstrated that AMPK is essential for mediating its actions (28Minokoshi Y. Kim Y.B. Peroni O.D. Fryer L.G. Muller C. Carling D. Kahn B.B. Nature. 2002; 415: 339-343Crossref PubMed Scopus (1670) Google Scholar). Whereas leptin exerts its catabolic effects in the periphery by stimulating AMPK phosphorylation and activation, its central effects on energy balance act through hypothalamic AMPK dephosphorylation and inhibition (23Andersson U. Filipsson K. Abbott C.R. Woods A. Smith K. Bloom S.R. Carling D. Small C.J. J. Biol. Chem. 2004; 279: 12005-12008Abstract Full Text Full Text PDF PubMed Scopus (639) Google Scholar, 24Minokoshi Y. Alquier T. Furukawa N. Kim Y.B. Lee A. Xue B. Mu J. Foufelle F. Ferre P. Birnbaum M.J. Nature. 2004; 428: 569-574Crossref PubMed Scopus (1332) Google Scholar). Linking systemic energy balance (appetite and autonomic nervous activity) with cellular AMP concentrations makes obvious “biological sense.” There are also leptin receptors in the hippocampus, suggesting a possible role for leptin signaling in cognition. The involvement of leptin and AMPK in brain function has heretofore not been addressed and is the subject of this report. We have used diet restriction (DR) tools to define the processes underlying the effects of nutrition on cognition and survival. Our results indicate that AMP kinase responds to nutritional status and modulates cognitive ability by affecting the balance between neurogenesis and neuroapoptosis. Leptin reverses the deleterious effects of severe DR, consistent with its role as a “survival” (anti-apoptotic) hormone under such stress conditions. Cells and Reagents—PC12 cells were kindly provided by O. Meyuhas, Department of Biochemistry, Faculty of Medicine, Hebrew University-Hadassah Medical School, Jerusalem. These cells were grown either in Dulbecco's modified Eagle's medium supplemented with 8% horse serum, 8% fetal bovine serum, glutamine, and gentamicin or with 1% horse serum in the presence of nerve growth factor (50 ng/ml), which causes the cells to differentiate. Murine leptin was provided by A. Gertler. AICAR was obtained from Toronto Research Chemicals. Mice—The experimental protocol was approved by the institutional committee for the use of animals, number MD-89.52-4. 8-10-week-old female Sabra mice (29-32g) were assigned at random to different groups of 10 mice. The food provided was Purina chow. Diet Restriction—Control mice received food ad libitum (AL). Diet-restricted mice received a diet of 57 kCal/week/mouse (2.16 g/day/mouse) as 60% of the requirement or 38 kCal/week/mouse (1.44 g/day/mouse) for 40% DR. DR was carried out for 10 days. Behavioral tests were performed using the eight-arm spatial maze during the second week of the experiment. During the behavioral tests, half the animals in each group were treated with AICAR (1-2 mm equal to 258-516 mg/kg) or leptin (1 mg/kg) and the other half with saline. The mice were treated with a dose of 1 mg/kg leptin based on previous experiments. We have evaluated the effect of 100-2000 μg/kg of body weight (intraperitoneal) on cognitive function and found that 1000-2000 μg/kg were the optimal dosages, whereas lower concentrations impaired it. 3E. M. Berry and Y. Avraham, unpublished observations. This dose is likely to lead to leptin concentrations in the high physiological range (∼100 ng/ml) in the injected animals (characteristic of obese subjects), which declined to lower concentrations after 24 h (29Dridi S. Williams J. Bruggeman V. Onagbesan M. Raver N. Decuypere E. Djiane J. Gertler A. Taouis M. Domest. Anim. Endocrinol. 2000; 18: 325-335Crossref PubMed Scopus (35) Google Scholar). AICAR and leptin were dissolved and diluted in saline. All administrations were given intraperitoneally in a volume of 0.1 ml/mouse. Mice were sacrificed by decapitation after the behavioral tests, and the hippocampi were frozen at -70 °C. RT-PCR Analysis—Total hippocampal RNA was extracted using Tri-Fast reagent according to the manufacturer's instructions and reverse transcribed. Primers specific for OBRlong were GATGTTCCAAACCCCAAGAA and CATAGCTGCTGGGACCATCT, for OBRshort ATCTGCCGGTGTGAGTTTTC and CCAGTCTCTTGCTCCTCACC, for BAX CTGAGCTGACCTTGGAGC and GACTCCAGCCACAAAGATG, for BCL-2 GACAGAAGATCATGCCGTCC and GGTACCAATGGCACTTCAAG, and for actin and All were by Analysis—Total hippocampal protein was extracted using Tri-Fast of the of protein were in mm and mm at for The were by and in a was by the in in for h at The were then to the diluted for 1 h at and were obtained from Cell and actin were from The were in and then with for 1 h at were by with Cell were grown in and treated with AICAR for was evaluated using the Research and cells were with at a of in of Dulbecco's modified Eagle's for and by were with in saline. were and in the on the were and through in mm in a at for into and to for of in were with activated diluted in for h at with for with and with for were as Y. Bonne O. Berry E.M. Brain Res. 1996; 732: 133-144Crossref PubMed Scopus (50) Google Scholar). The for and were performed by and using are as a animals were in an eight-arm maze that is a of that for D.S. R.J. J. Anim. 1976; 2: Scopus Google Scholar, J. J. Neurosci. PubMed Scopus Google Scholar). We used by and a of of at the of each The mice were of during into or 24 the lower the the the cognitive performance was each for days. were as under the the of in for each and the were for each the group was are as and or were evaluated by of and was carried out using the Hippocampal AMPK nutrition may cognitive function, hippocampal AMPK activity in to DR. Mice were assigned at random to different of DR for and then DR led to of AMPK phosphorylation in a a AMPK activation DR to 40% of the mice with mm AICAR a specific of this the hippocampal AMPK phosphorylation for by severe DR whereas a range of lower AICAR concentrations AMPK activation not AMPK and We the function of AMPK activation in the results that can AMPK a used which was demonstrated to hippocampal AMPK in a to these nutritional Mice were treated with and either or AICAR for 10 days. The number of cells in the dentate gyrus the of new cells and was increased from to following the performed behavioral using the eight-arm maze to was a in cognition. Mice treated with AICAR performed the and the effect of of hippocampal AMPK activation, mice were injected with of AICAR (1-2 for 10 days. Such concentrations for the dosages, of We also these findings were with in hippocampal-dependent spatial Mice given high dose AICAR a in maze performance with the group and in a to mice under DR to 40% the cellular mechanisms involved in these AMPK by RT-PCR and the with AICAR of BAX apoptosis AMPK an Cell in the cellular effects of AMPK in the hippocampus, also performed in studies using This cell is from cells and can be into a for these studies L.A. Proc. Natl. Acad. Sci. U. S. A. 1976; 73: PubMed Scopus Google Scholar). of cells with the of AICAR to a in the number of cells for mm and for total after h We also evaluated the apoptotic at h by cell that AICAR induces apoptotic cell death and for and 1 in a Leptin and is a key hormone in the of energy balance and is to AMPK activity in other C.T. Farooqi I.S. Whitehead J.P. Soos M.A. Rau H. Wareham N.J. Sewter C.P. Digby J.E. Mohammed S.N. Hurst J.A. Cheetham C.H. Earley A.R. Barnett A.H. Prins J.B. O'Rahilly S. Nature. 1997; 387: 903-908Crossref PubMed Scopus (2440) Google Scholar, Y. Kim Y.B. Peroni O.D. Fryer L.G. Muller C. Carling D. Kahn B.B. Nature. 2002; 415: 339-343Crossref PubMed Scopus (1670) Google Scholar). We considered leptin may with AMPK in brain We leptin under different of diet restriction. Mice were assigned at random to groups and DR to 60%, or DR to 40% for 10 days. leptin concentrations after of DR and were after of leptin by RT-PCR demonstrated an increasing of the with the of diet restriction. However, DR to 60% of the of the this was not in to 40% DR these the effects of leptin on hippocampal AMPK of 40% mice for h with 1 mg/kg leptin reduced the AMPK phosphorylation Leptin the of DR on and investigated the effects of leptin on neural function in mice. Mice were assigned at random to The groups were under or DR to 40% for 10 and injected with either 1 mg/kg leptin or for during the second with leptin the impaired eight-arm maze performance with DR to 40% the group was not by leptin performance was also in the not We then evaluated the effects on the concentrations of and in the with leptin the of following DR Leptin concentrations in the group not in the DR group in which concentrations were reduced the cellular mechanisms involved in leptin by RT-PCR and the between and Although leptin not hippocampal and of the it and reduced of DR mice. Although this effect was in RNA and protein BCL-2 was only in the protein suggesting the involvement of of demonstrated a in the following leptin suggesting an in the of survival We the effect of leptin by of activated as of apoptotic cell not be in the hippocampi of Leptin reduced the of the activated following 40% DR Leptin under Energy energy restriction to of neural function and leptin improves cognitive function following DR to 40% and neural investigated it may also mice survival under these severe conditions. mice were or DR to 40% for and leptin was by during the second week of the mice with leptin with in the group results using to leptin or continuously for animals in each of the or groups whereas in the DR groups a weight mice The survival in the treated group increased from to days. During the of survival on the ability to body when food was these also be the ability to and to stress The crucial of cognitive function under such of We these mechanisms were to survival of the We the of cellular energy nutritional balance, and cognitive function through the cellular and systemic actions of AMPK and actions survival. cellular AMPK activity, which is of the in the This activity has a on cell We that AMPK may cellular changes in the of these mechanisms in the hippocampus that AMPK is of cell neurogenesis and neuroapoptosis. The function of AMPK as a neurogenesis is in with its role in neural J.A. C. M. K. G. D. J. 2002; PubMed Scopus Google Scholar). It a for neuronal and cognitive function during mild energy restriction. these findings may the effects of DR found in neurodegenerative (6Duan W. Mattson M.P. J. Neurosci. Res. 1999; 57: 195-206Crossref PubMed Scopus (396) Google Scholar, 7Love R. Lancet Neurol. 2005; 4: 84Abstract Full Text Full Text PDF PubMed Scopus (20) Google Scholar) and in the suppression of deficits in learning and memory (6Duan W. Mattson M.P. J. Neurosci. Res. 1999; 57: 195-206Crossref PubMed Scopus (396) Google Scholar). The is that the actions of AMPK are to of mild energy it and increases cellular ATP. However, energy intake is as in severe diet cell are not to reverse the and AMPK activation to apoptosis R.J. M. N. R.L. L.A. R.A. Proc. Natl. Acad. Sci. U. S. A. 2004; 101: PubMed Scopus Google Scholar). This of AMPK function the effects of and severe DR on cognitive function of hippocampal cell Leptin concentrations were not different and declined following or 40% DR. the of leptin was in the hippocampus only when energy was to This is in with other the in hypothalamic leptin receptors under energy restriction and reduced leptin activity C. T. C. S. C. A. J.M. M. 2002; PubMed Scopus Google Scholar). The leptin to the of receptors and the of mice are to of the of the C. C.M. Jr., J.E. M. Friedman J.M. Nat. 1996; PubMed Scopus Google Scholar). this is by the is J. J. Endocrinol. 2004; PubMed Scopus Google Scholar). under energy restriction to 60%, leptin signaling is preserved by mechanisms of severe DR this The that leptin inhibit the phosphorylation of AMPK and the and behavioral deficits following 40% DR the of its signaling in the effects of severe energy restriction. This a role for leptin as a to AMPK in the hippocampus in to neural function under such conditions. AMPK of a of neural Diet restriction concentrations AMPK as a to impaired learning and However, of leptin function AMPK activation, increases and improves cognitive function C.T. D. M. B. Science. PubMed Scopus Google Scholar). the involvement of in the apoptotic effects of as of has been found to apoptosis and survival I. E. N. D. A. D. A. Neurosci. Lett. PubMed Scopus Google Scholar). leptin and induces neural survival. The from is that AMPK to neural energy to hippocampal function, it However, when AMPK is to the as in severe diet it neuronal AMPK is a factor in the balance between neuronal growth and death in to nutritional status and The of these results is that a of AMPK activation is whereas a is AMPK is a may be benefits to dose of AMPK in the of cognitive the function of leptin as a is crucial for the of neuronal activity during in energy status results leptin the survival of mice under severe diet restriction by stimulating is information leptin and the effects of and energy balance, is its function during It that following mild leptin may improve brain function, an obvious to the However, under severe diet restriction these effects The in to its other leptin cognitive function and survival under these results are found to be to Man, then leptin may be used in the of disease by or energy balance. These and stress and the weight loss with severe found in or which was considered to be a for may in a new role in the of stress with and We N. B. and H. for the

Récupéré en direct depuis OpenAlex et désinversé. Les résumés ne sont pas conservés dans cette base de données : les index inversés représentent 8,6 Go des 9,3 Go de texte de la base, et le serveur dispose de 13 Go libres.

Comment cette classification a été obtenuedéplier

Prédiction distillée sur la base complète

Imitation des enseignants

Ni prévalence calibrée, ni vérité terrain. Validation humaine à venir. Apprise à partir de 10 348 étiquettes directes de Codex et de 10 348 étiquettes directes de Gemma. Le mode candidate est l'union des têtes enseignantes seuillées; le consensus est leur intersection. Ces sorties portent le statut machine_predicted_unvalidated et ne sont ni des étiquettes humaines ni des étiquettes directes de modèles de pointe.

score de la tête « metaresearch » (Codex)0,000
score de la tête « metaresearch » (Gemma)0,000
Version: codex-gemma-dda1882f352aStatut de validation: machine_predicted_unvalidated
Catégories candidatesaucune
Catégories consensuellesaucune
DomaineSignal candidat: aucune · Signal consensuel: aucune
Devis d'étudeSignal candidat: Expérimental (laboratoire) · Signal consensuel: Expérimental (laboratoire)
GenreSignal candidat: Empirique · Signal consensuel: Empirique
Score de désaccord entre enseignants0,049
Score d'incertitude au seuil0,540

Scores Codex et Gemma par catégorie

CatégorieCodexGemma
Métarecherche0,0000,000
Méta-épidémiologie (sens strict)0,0000,000
Méta-épidémiologie (sens large)0,0000,000
Bibliométrie0,0000,000
Études des sciences et des technologies0,0000,000
Communication savante0,0000,000
Science ouverte0,0000,000
Intégrité de la recherche0,0000,000
Charge utile insuffisante (le modèle a refusé de juger)0,0000,000

Scores machine (provisoires)

Les deux têtes enseignantes du modèle étudiant, lues sur ce travail. Un score ordonne la base pour la relecture; il n'affirme jamais une catégorie, et le statut de validation accompagne chaque rangée tel quel.

Scores de référence d'un modèle non mature (critères de maturité non atteints, 7 itérations). Un score ordonne; il n'affirme jamais une catégorie.

Tête enseignante Opus0,039
Tête enseignante GPT0,274
Écart entre enseignants0,235 · la distance entre les deux têtes enseignantes sur ce seul travail
Statut de validationscore_only:v0-immature-baseline · tel quel depuis la passe de notation : score_only signifie que le nombre peut ordonner les travaux, et qu'aucune étiquette de catégorie n'en découle

Classification

machine, non validée

Prédiction automatique; un appel candidat d’une seule tête enseignante, pas un consensus.

Les modèles n’ont appliqué aucune catégorie : rien dans la taxonomie ne correspondait à ce travail.
Devis d'étudeExpérimental (laboratoire)
Domainenon disponible
GenreEmpirique

Le détail, modèle par modèle et score par score, se trouve en fin de page sous « Comment cette classification a été obtenue ».

En bref

Citations112
Publié2005
Routes d'admission1
Résumé présentoui

Explorer davantage

Même revueJournal of Biological ChemistryMême sujetRegulation of Appetite and ObesityTravaux en français237 207