Interleukin-12- and Gamma Interferon-Dependent Protection against Malaria Conferred by CpG Oligodeoxynucleotide in Mice
Notice bibliographique
Résumé
Unmethylated CpG dinucleotides in bacterial DNA or synthetic oligodeoxynucleotides (ODNs) cause B-cell proliferation and immunoglobulin secretion, monocyte cytokine secretion, and activation of natural killer (NK) cell lytic activity and gamma interferon (IFN-gamma) secretion in vivo and in vitro. The potent Th1-like immune activation by CpG ODNs suggests a possible utility for enhancing innate immunity against infectious pathogens. We therefore investigated whether the innate immune response could protect against malaria. Treatment of mice with CpG ODN 1826 (TCCATGACGTTCCTGACGTT, with the CpG dinucleotides underlined) or 1585 (ggGGTCAACGTTGAgggggG, with g representing diester linkages and phosphorothioate linkages being to the right of lowercase letters) in the absence of antigen 1 to 2 days prior to challenge with Plasmodium yoelii sporozoites conferred sterile protection against infection. A higher level of protection was consistently induced by CpG ODN 1826 compared with CpG ODN 1585. The protective effects of both CpG ODNs were dependent on interleukin-12, as well as IFN-gamma. Moreover, CD8+ T cells (but not CD4+ T cells), NK cells, and nitric oxide were implicated in the CpG ODN 1585-induced protection. These data establish that the protective mechanism induced by administration of CpG ODN 1585 in the absence of parasite antigen is similar in nature to the mechanism induced by immunization with radiation-attenuated P. yoelii sporozoites or with plasmid DNA encoding preerythrocytic-stage P. yoelii antigens. We were unable to confirm whether CD8+ T cells, NK cells, or nitric oxide were required for the CpG ODN 1826-induced protection, but this may reflect differences in the potency of the ODNs rather than a real difference in the mechanism of action of the two ODNs. This is the first report that stimulation of the innate immune system by CpG immunostimulatory motifs can confer sterile protection against malaria.
Récupéré en direct depuis OpenAlex et désinversé. Les résumés ne sont pas conservés dans cette base de données : les index inversés représentent 8,6 Go des 9,3 Go de texte de la base, et le serveur dispose de 13 Go libres.
Comment cette classification a été obtenuedéplier
Prédiction machine sur la base complète
Imitation des enseignantsNi prévalence calibrée, ni vérité terrain. Validation humaine à venir. Le volet Gemma est une étiquette directe du modèle pour chaque travail de la base, lue sur la notice réduite au titre. Le volet Codex est un classifieur appris des 10 348 étiquettes directes de Codex et calibré sur les taux pondérés de l'échantillon; les champs sans appui suffisant ne portent aucun appel Codex. Le mode candidate est l'union des deux volets; le consensus est leur intersection. Ces sorties portent le statut machine_predicted_unvalidated et ne sont pas des étiquettes humaines.
Scores du classifieur distillé par catégorie (deux têtes)
| Catégorie | Codex | Gemma |
|---|---|---|
| Métarecherche | 0,001 | 0,000 |
| Méta-épidémiologie (sens strict) | 0,001 | 0,001 |
| Méta-épidémiologie (sens large) | 0,001 | 0,001 |
| Bibliométrie | 0,001 | 0,000 |
| Études des sciences et des technologies | 0,000 | 0,001 |
| Communication savante | 0,000 | 0,000 |
| Science ouverte | 0,000 | 0,000 |
| Intégrité de la recherche | 0,001 | 0,002 |
| Charge utile insuffisante (le modèle a refusé de juger) | 0,003 | 0,001 |
Scores machine (provisoires)
Les deux têtes enseignantes du modèle étudiant, lues sur ce travail. Un score ordonne la base pour la relecture; il n'affirme jamais une catégorie, et le statut de validation accompagne chaque rangée tel quel.
Scores de référence d'un modèle non mature (critères de maturité non atteints, 7 itérations). Un score ordonne; il n'affirme jamais une catégorie.
score_only:v0-immature-baseline · tel quel depuis la passe de notation : score_only signifie que le nombre peut ordonner les travaux, et qu'aucune étiquette de catégorie n'en découleClassification
machine, non validéePrédiction automatique; un appel candidat d’une seule source (Gemma direct ou Codex distillé), pas un consensus.
Le détail, modèle par modèle et score par score, se trouve en fin de page sous « Comment cette classification a été obtenue ».