Janus kinase inhibition for autoinflammation in patients with DNASE2 deficiency

Defective elimination of nucleic acids can trigger autoinflammatory and autoimmune processes.1Lazear H.M. Schoggins J.W. Diamond M.S. Shared and distinct functions of type I and type III interferons.Immunity. 2019; 50: 907-923Abstract Full Text Full Text PDF PubMed Scopus (444) Google Scholar Mice lacking the lysosomal endonuclease DNase II have shown intracellular DNA accumulation, leading to severe anemia and embryonic death.2Kawane K. Requirement of DNase II for definitive erythropoiesis in the mouse fetal liver.Science. 2001; 292: 1546-1549Crossref PubMed Scopus (297) Google Scholar Human subjects carrying homozygous nonsynonymous loss-of-function mutations in DNASE2 complete gestation but are severely affected by congenital anemia and an inflammatory disorder characterized by splenomegaly, glomerulonephritis, liver fibrosis, circulating anti-DNA autoantibodies, and progressive arthritis.3Rodero M.P. Tesser A. Bartok E. Rice G.I. Della Mina E. Depp M. et al.Type I interferon-mediated autoinflammation due to DNase II deficiency.Nat Commun. 2017; 8: 2176Crossref PubMed Scopus (129) Google Scholar We describe a patient with a novel hypomorphic homozygous missense mutation in DNASE2 (c.A284G; p.Y95C) resulting in severe autoinflammation, failure to thrive, hemophagocytic lymphohistiocytosis (HLH), early-onset chronic intestinal inflammation, and suppression of hematopoiesis. Beyond the recent description of this disorder in 3 patients,3Rodero M.P. Tesser A. Bartok E. Rice G.I. Della Mina E. Depp M. et al.Type I interferon-mediated autoinflammation due to DNase II deficiency.Nat Commun. 2017; 8: 2176Crossref PubMed Scopus (129) Google Scholar we further characterize cytokine dysregulation and demonstrate successful treatment with the Janus kinase (JAK) 1/2 inhibitor baricitinib. The proband (V-2) is a 14-year-old Somalian girl from an endogamous kindred with a history of neonatal anemia (Fig 1, A). At 6 years of age, patient V-2 was referred for pyrexia, a history of pancytopenia, hepatosplenomegaly, failure to thrive (height and weight less than the 0.4th percentile), chronic diarrhea, and delayed motor skill development. Investigations (summarized in Table E1 in this article’s Online Repository at www.jacionline.org) revealed severe pancytopenia requiring multiple transfusions of red cells and platelets. Intestinal histology from endoscopic biopsy specimens revealed multiple granuloma-like cells within mucosa-associated lymphoid tissue compatible with phagocytosed DNA fragments (pseudogranuloma). Magnetic resonance imaging of the brain revealed biparietal deep white matter parenchymal signal abnormalities (Fig 1, B). Bone marrow studies identified macrophage infiltration and associated hemophagocytosis (Fig 1, C). At 9 years of age, the patient experienced severe EBV infection, necessitating treatment with dexamethasone and rituximab. Typical HLH criteria were met (see Table E1). She responded partially to the HLH-2004 chemotherapy treatment protocol, which she received for 7 weeks,4Henter J.-I. Horne A. Aricó M. Egeler R.M. Filipovich A.H. Imashuku S. et al.HLH-2004: diagnostic and therapeutic guidelines for hemophagocytic lymphohistiocytosis.Pediatr Blood Cancer. 2007; 48: 124-131Crossref PubMed Scopus (3219) Google Scholar with cessation of fever and improvement in diarrhea but ongoing pancytopenia and hepatosplenomegaly. For several years, transfusion-dependent anemia, chronic diarrhea, and severe growth retardation were observed. Homozygosity mapping and whole-exome sequencing revealed a rare homozygous variant in DNASE2 (c.284A>G; p.Y95C; see Fig E1, A, and Table E2 in this article’s Online Repository at www.jacionline.org). The affected variant is highly conserved across species (Fig 1, D). We used structural data of the existing DNase II homodimer complexed with a double-stranded DNA crystal structure from Burkholderia thailandensis to model the human DNase II.5Varela-Ramirez A. Abendroth J. Mejia A.A. Phan I.Q. Lorimer D.D. Edwards T.E. et al.Structure of acid deoxyribonuclease.Nucleic Acids Res. 2017; 45: 6217-6227Crossref PubMed Scopus (3) Google Scholar Residue Y95 is closely packed with residue T114, which is central to the nuclease catalytic HxK motif (H113 and K115), suggesting that small perturbations at residue 95 might have a significant effect on catalytic activity. The 2 recently published mutations in DNASE2 (p.G116A and p.D121V)3Rodero M.P. Tesser A. Bartok E. Rice G.I. Della Mina E. Depp M. et al.Type I interferon-mediated autoinflammation due to DNase II deficiency.Nat Commun. 2017; 8: 2176Crossref PubMed Scopus (129) Google Scholar will likely disrupt the same catalytic domain (Fig 1, E). The p.Y95C variant completely abolishes DNase II activity in a single radial enzyme diffusion (see Fig E1, B) and confers loss of function of the protein rather than absence (see Fig E1, C and D). Furthermore, granulocyte lysates from patient V-2 confirmed a deficiency in degrading DNA (Fig 1, F). Macrophages show the greatest expression of DNASE2 and are most likely affected in DNase II–deficient patients (see Fig E2, A, in this article’s Online Repository at www.jacionline.org). We observed increased lysosomal DNA accumulation in monocyte-derived macrophages from patient V-2 compared with control cells (see Fig E2, B). Similarly, clearance of exogenous apoptotic or bacterially derived DNA was reduced in macrophages from patient V-2 (see Fig E2, C and D). To investigate whether DNase II deficiency causes a selective DNA degradation defect or broadly affects lysosomal function, we tested antimicrobial activity in macrophages from patient V-2 (see Fig E2, E). Normal antimicrobial activity suggests that the defect in patients with DNASE2 deficiency is restricted to the inability to clear DNA. Previous studies emphasized that deficiency in DNASE2 in human subjects and mice results in induction of interferon- and non–interferon-mediated inflammation.2Kawane K. Requirement of DNase II for definitive erythropoiesis in the mouse fetal liver.Science. 2001; 292: 1546-1549Crossref PubMed Scopus (297) Google Scholar,3Rodero M.P. Tesser A. Bartok E. Rice G.I. Della Mina E. Depp M. et al.Type I interferon-mediated autoinflammation due to DNase II deficiency.Nat Commun. 2017; 8: 2176Crossref PubMed Scopus (129) Google Scholar,6Pawaria S. Moody K. Busto P. Nündel K. Choi C.-H. Ghayur T. et al.Cutting edge: DNase II deficiency prevents activation of autoreactive B cells by double-stranded DNA endogenous ligands.J Immunol. 2015; 194: 1403-1407Crossref PubMed Scopus (41) Google Scholar,7Kawane K. Tanaka H. Kitahara Y. Shimaoka S. Nagata S. Cytokine-dependent but acquired immunity-independent arthritis caused by DNA escaped from degradation.Proc Natl Acad Sci U S A. 2010; 107: 19432-19437Crossref PubMed Scopus (84) Google Scholar Increased levels of TNF, monocyte chemoattractant protein 1, IL-18, IFN-2α, IFN-β, and IFN-γ were detected in sera of patient V-2 (Fig 1, G). Increased levels of TNF, IL-1β, interferon-inducible protein 10, and IL-8 were observed in fibroblasts from patient V-2 (see Fig E3, A, in this article’s Online Repository at www.jacionline.org). p.Y95C macrophages showed high levels of TNF and IL-18, modestly increased levels of IL-1β, and a clear induction of type I interferons (see Fig E3, B), which we also confirmed to be present in one of the previously described patients (see Fig E3, B).3Rodero M.P. Tesser A. Bartok E. Rice G.I. Della Mina E. Depp M. et al.Type I interferon-mediated autoinflammation due to DNase II deficiency.Nat Commun. 2017; 8: 2176Crossref PubMed Scopus (129) Google Scholar Type I interferons (IFN-α and IFN-β) bind to type I receptors (IFN-α/β receptor 1/2) and induce the activation of JAK1 and tyrosine kinase 2, leading to signal transducer and activator of transcription 1 and 2 phosphorylation and interferon-stimulated gene (ISG) expression.8Ivashkiv L.B. Donlin L.T. Regulation of type I interferon responses.Nat Rev Immunol. 2014; 14: 36-49Crossref PubMed Scopus (1766) Google Scholar Because the immunotype of patient V-2 was indicative of a strong ISG signature, we explored JAK inhibition as a therapeutic option. In vitro JAK1/JAK2 blockade with baricitinib reduced ISG expression in fibroblasts from control subjects and patient V-2 and control macrophages after IFN-α stimulation (see Fig E4, A and B, in this article’s Online Repository at www.jacionline.org). In contrast, selective blockade of JAK2 using AG490 did not revert the ISG signature (see Fig E4, A). In healthy macrophages baricitinib treatment had stronger effects on ISG reduction compared with fibroblasts (see Fig E4, B). IFN-α–induced IL-18 levels were reduced after baricitinib or AG490 treatment (see Fig E4, C), suggesting a contribution of JAK2 signaling to IL-18 production in control macrophages. Because JAK inhibitors are effective in several interferonopathies9Sanchez G.A.M. Reinhardt A. Ramsey S. Wittkowski H. Hashkes P.J. Berkun Y. et al.JAK1/2 inhibition with baricitinib in the treatment of autoinflammatory interferonopathies.J Clin Invest. 2018; 128: 3041-3052Crossref PubMed Scopus (291) Google Scholar and baricitinib reverted the inflammatory signature in fibroblasts and macrophages in vitro, we treated our otherwise therapy-nonresponsive patient with baricitinib. We started with a 2-mg oral dose once daily, increasing weekly by 2 mg to achieve a final target dose of 6 mg (2 mg 3 times a day). Baricitinib was well tolerated with no adverse events and resulted in rapid and sustained clinical improvement (now for >6 months). In particular, the improved energy levels reported by the patient and the ability to attend school full-time were relevant patient-reported outcomes. Weight gain improved (Fig 2, A), and the patient underwent menarche 4 months after starting baricitinib. Blood parameters (Fig 2, B), gastrointestinal symptoms, and fecal calprotectin levels improved (Fig 2, B). Baricitinib decreased ISG expression in peripheral blood and cytokine levels compared with pretreatment levels (Fig 2, C-E). After 6 months of treatment, however, although the ISG signature indicated normalization of SIGLEC1 and ISG15, there was an upward trend of IFIT1, IFI44L, RSDA2, IL18, and IFI27, despite ongoing therapeutic response. Our data suggest that JAK1/2 inhibition is a rational and effective treatment for DNase II deficiency. In conclusion, we describe an additional patient with human DNase II deficiency who presented with HLH and early-onset intestinal inflammation, expanding the phenotypic spectrum of DNase II deficiency. We characterize the mechanisms underpinning the complex immunophenotype and show in a single patient that blocking JAK1/JAK2 with baricitinib can be used to curb pathologic interferon signaling caused by an inability to clear intracellular DNA. We thank the patients and their families, as well as healthy volunteers, for consenting to this research. We thank Yanick Crow, Jan Rehwinkel, Anne Bridgeman, Jonny Hertzog, and Julie Schulthess for critical input and research materials. This study was approved by the Bloomsbury Ethics Committee (no. 08H071382), the Oxford GI biobank (no. 09/H1204/30), and the Comité de Protection des Personnes (ID-RCB/EUDRACT 2014-A01017-40) in France. We obtained written informed consent from all family members and adolescent healthy control subjects with local ethics approval (REC 11/LO/0330). All 5 family members were genotyped with the Illumina cytoSNP12 chip (Illumina, San Diego, Calif). Two hundred nanograms of DNA was isothermally amplified overnight and then enzymatically fragmented. The fragmented DNA was incubated on a BeadChip overnight. These were imaged with the Illumina iScan System. Regions of homozygosity were identified by using the Illumina BeadStudio with the loss-of-heterozygosity detector plug-in (version 1.0.3). The minimum number of contiguous homozygous single nucleotide polymorphisms was set to 100. Whole-exome sequencing was completed by using the Illumina platform and sequenced on the Illumina HiSeq2000. Raw sequence data were aligned to the human reference genome by using the Burrows-Wheeler Aligner algorithm. Variant calling was performed with the Genome Analysis Toolkit, and variants were annotated with wANNOVAR. The DNASE2 variant was confirmed and familial segregation was ascertained by using PCR and Sanger sequencing with the following primers to amplify and sequence exon 3: forward, GCCTTCTCTTCCCTCTCTCC; reverse, GTCAGGGGTTACCTTGGAAAAAT. Sanger sequencing was performed with the AB3730 Analyzer with the BigDye v3.1 kit (Applied Biosystems, Foster City, Calif). Multiple DNASE2 sequences were aligned by using ClustalW2.E1Goujon M. McWilliam H. Li W. Valentin F. Squizzato S. Paern J. et al.A new bioinformatics analysis tools framework at EMBL-EBI.Nucleic Acids Res. 2010; 38(Web Server): W695-W699Crossref Scopus (1303) Google Scholar Data obtained from the sequence alignment are based on the following National Center for Biotechnology Information accession numbers: Homo sapiens, AAH10419.3; Rattus norvegicus, NP_612548.1; Pan troglodytes, XP_001170388.1; Canis lupus, XP_533902.3; Mus musculus, NP_034192.1; Drosophila melanogaster, NP_650672.1; Caenorhabditis elegans, NP_491414; Burkholderia thailandensis, WP_009895252.1; and Burkholderia pseudomallei, YP_111989.1. Structural models and figures were prepared by using the ICM software package (MolSoft, San Diego, Calif). A homology model for human DNase II was prepared by using the existing structure from B thailandensis (PDB 5UNB) as the model template. Double-stranded DNA (PDB 2BNA) was positioned manually at the dimer interface to indicate the potential DNA-binding surface, as previously highlighted.E2Varela-Ramirez A. Abendroth J. Mejia A.A. Phan I.Q. Lorimer D.D. Edwards T.E. et al.Structure of acid deoxyribonuclease.Nucleic Acids Res. 2017; 45: 6217-6227Crossref PubMed Scopus (10) Google Scholar All coordinate files were obtained from the Protein Data Bank (http://www.rcsb.org). PBMCs were isolated from 15 mL of blood from the patient and control subjects by using density gradient centrifugation (Lymphoprep; STEMCELL Technologies, Vancouver, British Columbia, Canada) and cultured in RPMI 1640 with glutamine (Sigma-Aldrich, St Louis, Mo) supplemented with 10% FCS. PBMCs (4 × 106) were plated, and after 2 hours, adherent monocytes were washed and cultured in the presence of 100 ng/mL macrophage colony-stimulating factor (PeproTech, Rocky Hill, NJ) for 5 days to differentiate them to macrophages. PBMCs were sorted with fluorescence-activated cell sorting from healthy donor blood by using canonical cell population surface markers: dendritic cell CD1c+ (clone B-Ly6; (clone San Diego, and (clone (clone cell (clone and (clone (clone (clone B-Ly6; cell (clone dendritic cell (clone and monocyte (clone were from the after the blood gradient by red blood cells with Calif). × 106) from the patient and control subjects were in of 5 or and at in the presence of and were at for 15 and were was in incubated with 2 of DNA and were incubated for at of was on and an at in the presence of 1 × for 1 were acquired on the analysis was with software of The human DNASE2 sequence was the expression H. T. T. Y. et of the human PubMed Scopus Google Scholar and used as a The variant to p.Y95C in DNASE2 was the by using the kit sequences of the were confirmed by using DNA sequence of used for was performed with the DNase II activity in the cells was by using the single radial enzyme diffusion with an imaging to our M. H. J. K. et and expression analysis of all 7 single nucleotide polymorphisms in the human II with potential to 2010; PubMed Scopus Google Scholar The activity of DNase II was as and that of the DNase II was to the Macrophages (2 × from control subjects and the patient were on a and to for 2 were with for and washed with To the ability of macrophages to DNA from apoptotic were for 4 with Technologies, apoptotic cells at a was by of a for after 4 of the apoptotic was confirmed by using fluorescence-activated cell sorting for and to the ability of macrophages to DNA from were for 1 with 9 at a of of and then for 4 In all 2 the of macrophages were with were with for at and then were with a by using Calif). were with a and with Macrophages at 5 of were with for 5 and Macrophages (2 × were well in were with at a of of for 1 by 2 of treatment with 100 were then in lysates with of 1 × and and cell lysates were in that were incubated overnight at were donor macrophages × and fibroblasts × were or treated with baricitinib AG490 and for 1 in a After treatment, macrophages and fibroblasts were or with IFN-α for in the presence of the blood was We used a kit for blood and the for from macrophages and The was with a was to by using the kit (Applied We performed PCR analysis using the and the The of of 6 IFIT1, IFI44L, ISG15, and and was to the expression of or by using levels were in the sera of patients and control subjects and in of fibroblasts using a kit to the sera was obtained from adolescent healthy control subjects with local ethics approval (REC reference age, macrophage were for TNF, IL-1β, and IL-18 using the All or the U were with software (version All were at a minimum in otherwise of less than were with the homozygous DNASE2 p.Y95C variant have DNA clearance A, DNASE2 gene expression of sorted human cells from healthy control subjects that macrophages show the greatest expression of and B, and of DNA in of macrophages from the patient and control subjects with and was increased lysosomal DNA accumulation in monocyte-derived macrophages from patient V-2 compared with control C and and of exogenous DNA in cell of macrophages from patients and control subjects with and then with apoptotic cells (Fig 2, and of Fig 2, D). macrophages from patient V-2 and 2 previously reported with the homozygous mutation showed reduced clearance of exogenous apoptotic or bacterially derived DNA. of monocyte-derived macrophages from patient V-2 and control subjects showed antimicrobial activity. The data of cytokine in fibroblasts and macrophages derived from proband V-2 with the homozygous p.Y95C DNASE2 A, Increased levels of IL-1β, interferon-inducible protein and by of and of gene expression of the and in fibroblasts from patient V-2 compared with control B, Increased levels of IL-18, and by using and of gene expression of the and in macrophages from patient V-2 compared with control expression of and in macrophages from a patient with the homozygous DNASE2 variant and healthy control macrophages was also performed and is presented for of in vitro JAK1/JAK2 blockade on type I interferon signature and IL-18 A, of IFI44L, RSDA2, and from patient V-2 and control fibroblasts with and IFN-α stimulation in the presence and absence of baricitinib AG490 JAK2 and JAK1 for B, PCR of IFI44L, RSDA2, and from healthy donor macrophages with and IFN-α in the presence and absence of baricitinib or AG490 for PCR of and from healthy donor macrophages with and IFN-α in the presence and absence of baricitinib and AG490 for and V-2 and to the of clinical the of HLH hepatosplenomegaly, and hemophagocytosis in marrow (see of to the of clinical the of HLH hepatosplenomegaly, and hemophagocytosis in marrow (see × of × blood cell to the of clinical the of HLH hepatosplenomegaly, and hemophagocytosis in marrow (see × white blood cell of × to the of clinical the of HLH hepatosplenomegaly, and hemophagocytosis in marrow (see and of B, and cells but in 4 of cells on 3 to and of reduced cells for on 1 I with kinase to to expression cells for was but was not gene in identified with an of and to the of clinical the of HLH hepatosplenomegaly, and hemophagocytosis in marrow (see completed on 1 with by sequencing for causes of HLH and and in and in of to mutations receptor for to the of clinical the of HLH hepatosplenomegaly, and hemophagocytosis in marrow (see of 2 and have levels of less than with have levels of or To confirmed have had levels of than but this with of 2 to the of clinical the of HLH hepatosplenomegaly, and hemophagocytosis in marrow (see of 2 times with 4 times 1 and 1 to to the of clinical the of HLH hepatosplenomegaly, and hemophagocytosis in marrow (see and of of white blood cell of Normal of B, and cells but in 4 of cells on 3 to and of reduced cells for on 1 to to cells for was but was not in identified with an of completed on 1 with by and in and in of to for of 2 and have levels of less than with have levels of or To confirmed have had levels of than but this with of 2 of 2 times with 4 times 1 and 1 to in a new Table of identified after homozygosity mapping and whole-exome sequencing (see effect on protein from from further from further not confirmed after Sanger sequencing and present in of the from further present in of the from further on Sanger sequencing but a present in of the from further from further on Sanger final variant for further (see from further on Sanger variant causes and was in patient V-2 after enzyme analysis of biopsy from further from further on Sanger highly variant and was on Sanger in activation and a less from further from further in population was from the and the in were for further study after based on population and (see in a new in population was from the and the in were for further study after based on population and (see

Récupéré en direct depuis OpenAlex et désinversé. Les résumés ne sont pas conservés dans cette base de données : les index inversés représentent 8,6 Go des 9,3 Go de texte de la base, et le serveur dispose de 13 Go libres.