First Report of <i>Exserohilum pedicellatum</i> Causing Root Rot of Wheat (<i>Triticum aestivum</i>) in Uzbekistan

Wheat is the major staple food in Uzbekistan, and it occupies the largest harvested area (1,3 million hectares) in the country (USDA 2024). In June 2023, a survey was conducted to investigate root pathogens in wheat growing fields of Kaspi district in the Kashkadarya region of Uzbekistan. A total of 24 symptomatic plants with root rot and dark brown root lesions were collected from focal lesions in 4 different fields. From each plant, roots were excised and surface sterilized with 1% sodium hypochlorite for four minutes, then rinsed three times with sterile distilled water. Following surface sterilization, the excised roots were air dried in a laminar flow on sterile tissue sheets, rinsed twice with sterile distilled water, and then cut into 1 cm lengths segments (5 segments per one plant). The root pieces were cultured at 24°C for 4 days with a 12-hour photoperiod on potato dextrose agar supplemented with streptomycin (0.1 g/liter) and chloramphenicol (0.05 g/liter). From 24 symptomatic plants a 5 dematiaceous hyphomycete monoconidial pure isolates with abundant conidia were isolated. The conidia (n = 60) were mostly fusiform, straight, four to seven distoseptate, olivaceous brown to dark brown, and measured 51 to 88.7 × 17.9 to 25.4 μm (average 69.7 × 21.57 μm). Based on morphological characteristics the fungus was identified as E. pedicellatum according to Sivanesan (1987) and Hernandez-Restrepo et al. (2018). From five isolated monoconidial colonies, one has been chosen for molecular-genetic identification. Total DNA was extracted from it using PureLink™ Genomic DNA Mini Kit (Thermo Fisher Scientific, Waltham, MA, USA). For more informative analysis two loci, he translation elongation factor 1-alpha (tef1) and beta-tubulin (tub) genes were PCR-amplified and sequenced using gene specific primers: EF-1F （5'-CGGTGGTATCGACAAGCGT-3'), EF-2R （5'-AGCATGTTGTCGCCGTTGAAG-3'）designed by Primer3web v4.1.0 software (Untergasser et al. 2012), and Bt2a （5'- GGTAACCAAATCGGTGCTGCTTTC, Bt2b （5'-ACCCTCAGTGTAGTGACCCTTGGC -3'）described by Glass and Donaldson (1995), respectively. The resulting sequences were deposited in NCBI database under accession number PQ095881 and PQ095882. After BLAST analysis they showed highest similarity with the corresponding sequences of tef1 JQ672389 (100% identity, from 287 bp 287 bp are matching) and tub JQ671941 (100% identity, from 273 bp 273 bp are matching) of BMP 0384 isolate of E. pedicellatum from USA. In the plant inoculations (pathogenicity test), three isolates of E. pedicellatum were evaluated. For the pathogenicity test, conidia were scraped from PDA plate, suspended in water, and mixed with sterile sand to obtain a density of 500 conidia/g. A total of 20 wheat seed (Grom variety) previously disinfected 2 min with 10% NaOCl, were sown in each plastic pot (14 cm x 4 cm, 2 seeds per pot) filled with the inoculated soil (5 pots) and with sterilized soil (5 pots) as a control. Plants were grown in a growth chamber with a 12-h photoperiod at 24°C for 4 weeks. Plants grown in inoculated soil displayed symptoms on their roots similar to those observed in the field-grown plants, whereas the roots of the control plants remained asymptomatic. The fungus was reisolated from the symptomatic roots and confirmed morphologically and molecular genetically as E. pedicellatum, fulfilling Koch's postulates. To the best of our knowledge this is the first report of E. pedicellatum on wheat in Uzbekistan.Since phylogenetic analysis of the GPEB-70 strain showed clustering with strains from USA and also taking into account intensification of globalization in agriculture, rising of global seeds market and increasing demand for high-yielding USA and Canadian wheat seeds in Central Asian farmers, we speculate that there may have been a recent introduction of E. pedicellatum from USA into Uzbekistan. Given that wheat is an important and popular staple food in Uzbekistan, further work would focus on developing efficient strategies to manage this root rot disease, the development of effective management strategies for this root rot disease would be the main focus of future research.

Récupéré en direct depuis OpenAlex et désinversé. Les résumés ne sont pas conservés dans cette base de données : les index inversés représentent 8,6 Go des 9,3 Go de texte de la base, et le serveur dispose de 13 Go libres.