Role of the Phox Homology Domain and Phosphorylation in Activation of Serum and Glucocorticoid-regulated Kinase-3

Serum and glucocorticoid-regulated kinases (SGKs) form a family of serine/threonine protein kinases that exhibit structural and sequence similarity to the protein kinase B (PKB)/Akt family. The major difference between these two families is the absence of a lipid-binding, pleckstrin homology domain in the SGKs. Despite the absence of the pleckstrin homology domain, activation of the three human isoforms is, like PKB, dependent upon the phosphatidylinositol 3′-kinase (PI3K) pathway that is induced by growth factors and mitogens. Full-length SGK3 contains a complete Phox homology (PX) domain that targets the protein to endosomes. Both a functional PX domain and PI3K activation are necessary for phosphorylation of SGK3 at two regulatory sites (Thr-320 and Ser-486) and subsequent induction of kinase activity. PDK1 phosphorylates endosome-associated SGK3 at Thr-320, whereas diversion of SGK3 to the plasma membrane, where PDK1 normally activates PKB, interferes with PDK1 phosphorylation of SGK3. A chimeric protein in which the carboxyl-terminal hydrophobic motif (HM) of SGK3 has been exchanged for the HM of PRK2 is constitutively active. Finally, we demonstrate that SGK3 activation becomes PX domain-independent once the HM is phosphorylated. Taken together, these data indicate that the targeting of SGK3 to endosomes, mediated by its PX domain, is essential for proper SGK3 activation, likely due to co-localization of SGK3 with an endosomal, PI3K-dependent and staurosporine-sensitive HM kinase. Serum and glucocorticoid-regulated kinases (SGKs) form a family of serine/threonine protein kinases that exhibit structural and sequence similarity to the protein kinase B (PKB)/Akt family. The major difference between these two families is the absence of a lipid-binding, pleckstrin homology domain in the SGKs. Despite the absence of the pleckstrin homology domain, activation of the three human isoforms is, like PKB, dependent upon the phosphatidylinositol 3′-kinase (PI3K) pathway that is induced by growth factors and mitogens. Full-length SGK3 contains a complete Phox homology (PX) domain that targets the protein to endosomes. Both a functional PX domain and PI3K activation are necessary for phosphorylation of SGK3 at two regulatory sites (Thr-320 and Ser-486) and subsequent induction of kinase activity. PDK1 phosphorylates endosome-associated SGK3 at Thr-320, whereas diversion of SGK3 to the plasma membrane, where PDK1 normally activates PKB, interferes with PDK1 phosphorylation of SGK3. A chimeric protein in which the carboxyl-terminal hydrophobic motif (HM) of SGK3 has been exchanged for the HM of PRK2 is constitutively active. Finally, we demonstrate that SGK3 activation becomes PX domain-independent once the HM is phosphorylated. Taken together, these data indicate that the targeting of SGK3 to endosomes, mediated by its PX domain, is essential for proper SGK3 activation, likely due to co-localization of SGK3 with an endosomal, PI3K-dependent and staurosporine-sensitive HM kinase. Serum and glucocorticoid-regulated kinases (SGKs) 2The abbreviations used are: SGK, serum and glucocorticoid regulated kinase; GST, glutathione S-transferase; HM, hydrophobic motif; PI3K, phosphatidylinositol 3′-kinase; PI(3)P, phosphatidylinositol 3-phosphate; PKB, protein kinase B/Akt; PRK2, PKC-related kinase 2; PX, Phox homology; PLO, protein lipid overlay; PKC, protein kinase C; HM, hydrophobic motif; BSA, bovine serum albumin; Pipes, 1,4-piperazinediethanesulfonic acid; CISK, cytokine-independent survival kinase; PIP3, 3,4,5′-triphosphorylated phosphoinositide; PIF, PDK1 interacting fragment; myr, myristoylation. comprise a novel family of three serine/threonine protein kinases that show extensive sequence homology to the kinase domain of the protein kinase B (PKB)/Akt family. SGK1 was identified in a differential screen for glucocorticoid-inducible transcripts in a rat mammary tumor cell line (1Webster M.K. Goya L. Ge Y. Maiyar A.C. Firestone G.L. Mol. Cell. Biol. 1993; 13: 2031-2040Crossref PubMed Scopus (497) Google Scholar). Three isoforms of SGK have been identified in humans and are encoded by distinct genes: SGK1, SGK2, and SGK3 (2Kobayashi T. Cohen P. Biochem. J. 1999; 339: 319-328Crossref PubMed Scopus (527) Google Scholar, 3Kobayashi T. Deak M. Morrice N. Cohen P. Biochem. J. 1999; 344: 189-197Crossref PubMed Scopus (335) Google Scholar). All isoforms are post-translationally modified by phosphorylation and are regulated downstream of phosphatidylinositol 3′-kinase (PI3K) (2Kobayashi T. Cohen P. Biochem. J. 1999; 339: 319-328Crossref PubMed Scopus (527) Google Scholar, 3Kobayashi T. Deak M. Morrice N. Cohen P. Biochem. J. 1999; 344: 189-197Crossref PubMed Scopus (335) Google Scholar, 4Park J. Leong M.L. Buse P. Maiyar A.C. Firestone G.L. Hemmings B.A. EMBO. 1999; 18: 3024-3033Crossref PubMed Scopus (482) Google Scholar). Similar to PKB, the SGK isoforms are phosphorylated and activated by phosphoinositide-dependent kinase-1 (PDK1) at a threonine residue in the T-loop analogous to Thr-308 of PKBα. The PI3K pathway is involved in several important cellular functions, including insulin action, cell division, cell growth, and cell survival, and dysregulation of the pathway is implicated in a variety of diseases, including cancer and diabetes. One major structural difference between PKBs and SGKs is the absence of a phospholipid-binding pleckstrin homology domain near the amino terminus of the SGKs. This domain binds the 3,4,5′-triphosphorylated phosphoinositide (PIP3) lipid product of PI3K and causes recruitment of PKB and PDK-1 to the plasma membrane, the site of PIP3 synthesis. The initial isolate of a human SGK3 cDNA by sequence homology to SGK1 lacked a lipid binding domain. The mouse homologue of SGK3, termed cytokine-independent survival kinase (CISK), was identified from a genetic screen using retroviral mutagen vectors to identify factors that mediate interleukin-3-dependent survival of hematopoietic cells (5Liu D. Yang X. Songyang Z. Curr. Biol. 2000; 10: 1233-1236Abstract Full Text Full Text PDF PubMed Scopus (114) Google Scholar). The amino-terminal domain of CISK contained a region of similarity to Phox homology (PX) domains. These domains were first characterized in the enzyme NADPH phagocyte oxidase (6Sato T.K. Overduin M. Emr S.D. Science. 2001; 294: 1881-1885Crossref PubMed Scopus (204) Google Scholar) and have since been found in more than 100 eukaryotic proteins, such as t-Snare and sorting nexins that are involved in membrane trafficking (6Sato T.K. Overduin M. Emr S.D. Science. 2001; 294: 1881-1885Crossref PubMed Scopus (204) Google Scholar). Many PX domains have been shown to bind phosphatidylinositol 3′-monophosphate (PI(3)P) and to direct their respective proteins to early endosome structures within cells, where most of the cellular PI(3)P resides (7Gillooly D.J. Morrow I.C. Lindsay M. Gould R. Bryant N.J. Gaullier J.M. Parton R.G. Stenmark H. EMBO J. 2000; 19: 4577-4588Crossref PubMed Scopus (856) Google Scholar). Here we present the first in-depth investigation of the in vivo mechanism of activation of human SGK3. First, we confirmed that human SGK3, like CISK, contains a full PX domain that binds preferentially to the PI(3)P and that targets SGK3 to endosomes. By using phospho-specific antibodies, we demonstrated that phosphorylation of the activation loop (Thr-320) and the hydrophobic motif (Ser-486) residues, and therefore SGK3 activity, is dependent on PI3K and on the PX domain and that specifically targeting SGK3 to the plasma membrane is insufficient for in vivo phosphorylation. In addition, we assessed the roles of PDK1 and of a staurosporine-sensitive kinase in phosphorylating the activation loop and the hydrophobic motif (HM) of SGK3 in cells, respectively. We developed a novel form of constitutively active SGK3, a chimeric protein in which the HM of SGK3 is replaced with the HM of PKC-related kinase 2 (PRK2) (a potent mimic of phosphorylated HM), to demonstrate the importance of the SGK3 HM in activation. Finally, a PX domain mutant of SGK3 PRK2 revealed that activation of SGK3 becomes independent of its PX domain when the hydrophobic motif is phosphorylated. Taken together, these results suggest that the PX domain contributes to SGK3 activation by localizing SGK3 to endosomes where a PI3K-dependent and staurosporine-sensitive HM kinase participates in generating fully active SGK3. Cloning of Full-length Human SGK3 and Generation of Mutants—The human EST data base at NCBI was interrogated using CISK cDNA as a query. A human EST spanning the amino terminus and the kinase domain of CISK (Clone ID 4391699) was obtained from I.M.A.G.E. Consortium in pCMV-Sport6. Sequencing confirmed the presence of a full-length human SGK3 open reading frame in this EST. NotI and BamHI sites were introduced at the 5′ and 3′ ends of SGK3 using PCR (fwd, gcggccgcgatgcaaagagatcacacc; rev, ggatcctcacaaaaataagtcttctg) and subcloned into the p3XFLAG-CMV-10 mammalian expression vector (Sigma). Point mutations in SGK3 were generated by site-directed mutagenesis (QuickChange, Stratagene). Myristoylated SGK3 was generated by introducing XbaI and BamHI sites at the 5′ and 3′ ends of wild type SGK3 (fwd, gtctagaatgcaaagagatcacaccatggac; rev, ggatcccaaaaataagtcttctgaaggagg). The PCR product was then subcloned into a p3XFLAG-CMV-14 mammalian expression vector (Sigma) in which a myristoylation sequence had been introduced in the HindIII and KpnI sites. The portion of the wild type SGK3 cDNA corresponding to the PX domain (amino acids 1-136) was amplified by PCR. BamHI and NotI sites were introduced (fwd, ggatccatgcaaagagatcacaccatggac; rev, gcggccgcacttctttcatcctcatcttc), and the amplified product was subsequently subcloned into pGEX-4T-1 (Amersham Biosciences). SGK3-PRK2 was cloned using an adaptation of the Quick-Change (Stratagene) site-directed mutagenesis (8Geiser M. Cebe R. Drewello D. Schmitz R. BioTechniques. 2001; 31 (92): 88-90Crossref PubMed Scopus (212) Google Scholar). A standard PCR was carried out with a PRK2 EST (Image clone ID 2124101; GenBank™ accession I.M.A.G.E. as The HM of PRK2 was amplified by using that contained to SGK3 at their 5′ and from the HM of PRK2 at their 3′ This PCR product was on an and with The PCR product then as a in a PCR using of SGK3 in (Sigma) as This a where were from SGK3 and were from the HM of The was by the PCR for with and by cells All were In in and was carried out on EST (Clone ID 4391699) in from the from was used to the and cells and were in modified with bovine serum and at and cells were and with of using The the was and replaced with complete modified to cells were and in modified bovine serum cells were with a PI3K with PI3K with kinase were in Pipes, 100 and of a of (Amersham and of (Sigma) were to were for at The were three with were with by and to were for in and with the at as SGK3 and were with the at for were using to the cells were with and with kinase were carried out in a at for of the kinase was the was by were in and the of was by shown are data from three independent pGEX-4T-1 PX domain of SGK3 and mutant were into The proteins were induced with and at for were by at for and at proteins were using the bind to the and of the proteins were assessed by were for in with (Sigma). The proteins in with were with the at The were three for with and for at with in with The were three for with and for at with in with The were in with were on and using was on the cells at for were in and in in were with and then with with and respectively. were with and the were in was a and were with The PX of Human SGK3 PI(3)P and SGK3 to a human EST of mammary that from the PX domain of CISK to its kinase domain (Clone ID 4391699) a query. The EST contained the human SGK3 sequence as as a complete PX domain, the of which we to full-length SGK3. The SGK3 sequence a whereas the EST full-length SGK3 is to a The in protein was of a product that is from the and the protein a complete PX domain A protein the PX domain of SGK3 (amino acids 1-136) was with a membrane with and binding was using an This protein lipid has been used to the lipid binding of proteins Scholar). The PX domain of SGK3 and preferentially to PI(3)P, and to a to and of a residue within a for phosphatidylinositol binding Y. D. R. Songyang Z. J. Biol. binding to the These results demonstrate that the PX domain of human SGK3 is functional and that preferentially with This is to from the phosphorylation of phosphatidylinositol by type of cells with wild type SGK3 by revealed an when with for early a of the The of the PI(3)P in mammalian cells was to endosomes (7Gillooly D.J. Morrow I.C. Lindsay M. Gould R. Bryant N.J. Gaullier J.M. Parton R.G. Stenmark H. EMBO J. 2000; 19: 4577-4588Crossref PubMed Scopus (856) Google Scholar, D.J. Stenmark H. Biol. PubMed Scopus Google and the data the Human SGK3 whereas type SGK3 was into cells, which were then with an of and a potent of PI3K, with an of PI3K, and to an in kinase A of kinase was present upon with wild type SGK3. was upon with and this induction was by of the cells with the PI3K of SGK3 activation. The phosphorylation of SGK3 was using a to indicate activation loop site phosphorylation and using a motif to SGK3 for the of HM phosphorylation (Ser-486) revealed that phosphorylation at sites and that with phosphorylation of B and the in vivo phosphorylation of SGK3 its kinase activity. We to SGK3 phosphorylation with PI3K This that PI3K activation is necessary for SGK3 phosphorylation. of cells wild type SGK3 that upon activation, SGK3 of SGK3 cells with of endosomes, a to the of PI3K in endosome SGK3 was found to with a J. P. Hemmings B.A. D. Biol. PubMed Scopus Google Scholar, L. T. J.M. J. Biol. 2001; PubMed Scopus Google in the presence of that SGK3 is SGK3 is whereas is cells were with and with were on using as the shown are from three independent cells SGK3 were with with and were to using an SGK3 and site as in cells were with of wild type cells were with with of was carried out as in that was used as a of endosomes. of PX in SGK3 and in to PI3K the PX domain to SGK3 activation and we on cells the mutant of SGK3. This mutant a within the phosphoinositide binding that its binding to This mutant demonstrated and The of SGK3 due to the presence of an in its kinase domain G.L. B.A. Cell. Biochem. 13: PubMed Scopus Google Scholar) that when the PX domain is the PX domain SGK3 activity, we the phosphorylation of the activation sites of wild type and SGK3. to phosphorylation of the mutant on the activation loop HM site This that binding of the PX domain to PI(3)P is for SGK3 phosphorylation and that of the protein to endosomes is for the kinases to the for SGK3 phosphorylates PKB at the plasma membrane, and this by a myristoylation to the amino-terminal domain of PKB Mol. Cell. Biol. PubMed Scopus Google Scholar). this is the for retroviral activation of the of the kinase to the protein the of the kinase at the membrane where PDK1 to activated PubMed Scopus Google Scholar). the for endosome for activation by targeting SGK3 to the plasma membrane, we generated a of wild type SGK3 in which the myristoylation of was to the amino terminus 1999; PubMed Scopus Google Scholar). Despite the plasma membrane targeting that to endosomes that the PX domain is the myristoylation the was introduced into the PX domain of In the of the the mutant was to the plasma membrane this the was phosphorylated at the activation loop the hydrophobic motif sites in to By wild type SGK3 that was was phosphorylated to the SGK3. These data suggest that of SGK3 to endosomes is a for its activation of SGK3 of SGK3 at by on the PI3K of SGK3 and on from of PKB phosphorylation Mol. Cell. Biol. PubMed Scopus Google we the of PDK1 in activation of SGK3. cells were with wild type SGK3 and with wild type mutant PDK1 and phosphorylation of SGK3 was by expression of PDK1 induced phosphorylation of PDK1 within its of PDK1 with the hydrophobic motif in its kinase Deak M. EMBO J. 2000; 19: PubMed Scopus Google Scholar, Deak M. EMBO J. 2001; PubMed Scopus Google Scholar). The PDK1 mutant to SGK3 on that PDK1 on to SGK3. of PI3K with to phosphorylation of in the presence of that of this kinase the for PI3K A the of into the of the for the hydrophobic motif phosphorylation cells wild type SGK3 and PDK1 were with a kinase to protein PDK1 10: Full Text PDF PubMed Scopus Google Scholar). shown in and phosphorylation. This that staurosporine-sensitive kinase are for the activation loop and the hydrophobic motif phosphorylation. The importance of SGK3 kinase for its and phosphorylation was using a SGK3 This mutant demonstrated this of SGK3 is independent of its of cells wild type and SGK3 that the mutant is phosphorylated at in the presence of These data suggest that the in vivo phosphorylation of SGK3 is mediated in by PDK1 and in by a staurosporine-sensitive kinase that SGK3, kinase that is dependent upon of SGK3 Generation of a of the importance of phosphorylation of the hydrophobic motif in SGK3 we generated a chimeric protein where the SGK3 HM was replaced with the HM of PRK2 kinase This chimeric mutant was termed SGK3-PRK2 PRK2 is an kinase in that an of a residue in its the presence of the amino in the HM of PRK2 the phosphorylated of the HM of proteins such as PKB and SGK3. A the HM of PRK2 was found to with PDK1 and was termed Deak M. P. R. Curr. Biol. 1999; Full Text Full Text PDF PubMed Scopus Google Scholar). In addition, a of with the HM of PRK2 was in to a activated PKB J. P. D. Hemmings B.A. D. Mol. Cell. Full Text Full Text PDF PubMed Scopus Google Scholar, J. P. Hemmings B.A. D. Biol. PubMed Scopus Google Scholar). We first the of the PRK2 HM on SGK3 by its T-loop phosphorylation in of cells that the kinase mutant In the absence of the PI3K SGK3-PRK2 was phosphorylated on The of phosphorylation was by with likely recruitment of PDK1 these to phosphorylation of of These results that the SGK3-PRK2 mutant is constitutively and this was by in an in kinase using of These demonstrated that SGK3-PRK2 in the absence of a PI3K was by was by of a PI3K a mutant of SGK3 in which was to was mutant a constitutively active of the of the the corresponding to in SGK3-PRK2 with an phosphorylation the importance of an within the HM for activation of SGK3. SGK3-PRK2 an as by Finally, we the of SGK3-PRK2 expression on phosphorylation on of the targets of SGK1, kinase phosphorylation was with expression of that SGK3-PRK2 is an active kinase that the in the HM the of the wild type protein Taken together, these results demonstrate that SGK3 HM with the HM of PRK2 a kinase targeting downstream of PX the roles of the PX domain and phosphorylation of the HM in SGK3 activation, we generated a mutant of SGK3-PRK2 in which the PX domain was by the This mutant and the respective residue in the HM to are to endosomes as shown by We then the phosphorylation of in the of a HM and a PX domain. revealed that SGK3-PRK2 was phosphorylated at Thr-320, the PX domain These data suggest that the activation loop phosphorylation of SGK3 becomes independent of the PX domain when the hydrophobic motif is in a phosphorylated We the of a mutant in the of constitutively active SGK3, SGK3-PRK2 This mutant that SGK3 active is important for its activation. Taken together, results to an activation mechanism where the PX domain is for localizing SGK3 in the endosomes, that an staurosporine-sensitive in a PI3K-dependent phosphorylates the SGK3 hydrophobic in a PI3K-dependent to the phosphorylated HM of SGK3 and phosphorylates its activation loop fully active SGK3. The PI3K pathway is activated in human has on the of in these are that are including SGK3. to the of this kinase to PI3K we have the of activation of SGK3. The results demonstrate the of the PX domain in and subsequent phosphorylation and activation. By using antibodies, we the phosphorylation of SGK3 on its activation loop (Thr-320) and its hydrophobic motif (HM) (Ser-486) and from these a of SGK3 We confirmed that human SGK3 contains a functional PX domain that binds PI(3)P, the X. Y. 2001; PubMed Scopus Google Scholar). Despite the an in its is with the of SGK3. A of the CISK PX domain that its binding is to bind a with a phosphorylated Y. D. R. Songyang Z. J. Biol. Scholar). that human SGK3 bind to and The SGK3 PX domain we that preferentially binds PI(3)P in its cellular PIP3 is regulated by PI3K the of the PI(3)P within the This is the of and is to such as to the product of PI3K type is that PI3K type are for the of of revealed that PI3K are for PI(3)P L. T. J.M. J. Biol. 2001; PubMed Scopus Google Scholar). In a for PI(3)P was from the endosomes with that PI(3)P was fully by the type We have shown that SGK3 is to the endosomes with that SGK3 targeting to endosomes is independent of type PI3K activation. We have that SGK3 is present in the endosomes with that an in PIP3 SGK3 A PI3K a to with and to termed PI3K with a domain was found to preferentially to PI(3)P, to a PX domain and to to and J. Biochem. J. PubMed Scopus Google Scholar). is therefore that is at the of SGK3 to endosomes is dependent on its PX domain and on the presence of PI(3)P and on PI3K type activity. SGK3 phosphorylation of and and protein kinase are dependent on the PX domain and the two on PI3K on in this PI3K to PI3K type SGK3 mutant the PX domain to bind PI(3)P, is at endosomes, and is phosphorylated on the activation loop on the HM that the of SGK3 to endosomes is a for activation. co-localization of SGK3 and PDK1 at the membrane is insufficient to phosphorylation and activation of SGK3. Myristoylated of CISK has been shown to constitutively is to endosomes (5Liu D. Yang X. Songyang Z. Curr. Biol. 2000; 10: 1233-1236Abstract Full Text Full Text PDF PubMed Scopus (114) Google Scholar). results are with a for the PX domain in targeting that the of human and SGK3 are we that the activation of of a difference in the of the PDK1 phosphorylates on SGK3. A is PDK1 its to SGK3. has been that PI3K is present in endosomes H. M. D. J. Biol. PubMed Scopus Google Scholar, PubMed Scopus Google Scholar, Biochem. J. PubMed Scopus Google Scholar, D.J. T. M. Mol. Biol. Cell. PubMed Scopus Google and is that a of are to activated M. Mol. Biol. PubMed Scopus Google Scholar) and to and to in out cellular In this is that and PDK1 are into endosomes and are with SGK3. a suggest a in SGK3 activation, with activation of PKB at the plasma membrane, as as a upon and The importance of a phosphorylated HM is by the activation of and J. P. Hemmings B.A. D. Biol. PubMed Scopus Google Scholar) generated a protein of and the HM of This revealed that the of the HM is in binding of this domain to the amino-terminal of the kinase domain. This binding a of the which then with phosphorylated and the activation to a fully active kinase. These found that PRK2 was a for PDK1 for than with its HM Deak M. EMBO J. 2000; 19: PubMed Scopus Google Scholar). SGK3-PRK2 chimeric protein to a that results in activation. this mutant the of the SGK3 by hydrophobic with PDK1 and with to a fully active kinase. the of the HM and the PX domain in SGK3 activation, we the PX domain in SGK3-PRK2 to to wild type SGK3, the PX domain is to a phosphorylated and active form of SGK3 when the HM is phosphorylated in this a mimic of a phosphorylated HM), that important of the PX domain is to direct SGK3 to endosomes where is phosphorylated on its In of the that the SGK3 mutant targeting is phosphorylated for phosphorylation. The of phosphorylation of SGK3 and of SGK3 in the of constitutively active SGK3 that an active a in its mechanism of activation. results indicate that to endosomes is important for HM is that the SGK3 HM kinase constitutively in the endosomes. The HM kinase to endosomes, in to PI3K The for the HM kinase of PKB, such as and for SGK3 activation. the SGK family of kinases is most to the PKB is to their The first difference is the of their binding which proteins to cell PKB is and in the when of SGK3 in the once phosphorylated PKB, which from the plasma membrane into the and M. R. N.J. M. P. Cohen P. J.M. Hemmings B.A. J. Biol. Full Text Full Text PDF PubMed Scopus Google Scholar). The SGK3 to in to its HM kinase when whereas PKB membrane targeting is important for with PDK1 as a of its to respective pleckstrin homology domains. data the that SGK3, like SGK1 Deak M. EMBO J. 2001; PubMed Scopus Google more than PKB on motif with PDK1 for activation. is the of the HM kinase. SGK3 was phosphorylated on and phosphorylation was found to to In phosphorylation of PKB M. D. Hemmings B.A. J. Biol. 2001; Full Text Full Text PDF PubMed Scopus Google Scholar). We therefore that the of the kinases that the hydrophobic of PKB and SGK3 on their cellular A is the mechanism by which SGK3 is dependent upon PDK1 SGK3 to by this and the by phosphorylation of the This to the HM kinase as the PI3K-dependent of the SGK3 a in this is this is We were to SGK3 activation with that PI3K activation is necessary for SGK3 activation. is that the PI3K in with are to fully this HM kinase. We have data that SGK3 is to is of a family of lipid that PI(3)P and are by PubMed Scopus Google Scholar). The differential targeting of SGK3 and PKB in their and PKB is the of as a of its in several human the of SGK3 to these this as a The of a constitutively activated mutant of SGK3 of to the of activation of this protein kinase in We P. and for with

Fetched live from OpenAlex and de-inverted. Abstracts are not stored in this database: the inverted indexes are 8.6 GB of the frame’s 9.3 GB of text, and the host has 13 GB free.