MétaCan
Menu
Back to cohort
Record W2028298716 · doi:10.1128/aem.03147-14

Erratum for Maheux et al., Abilities of the mCP Agar Method and CRENAME Alpha Toxin-Specific Real-Time PCR Assay To Detect Clostridium perfringens Spores in Drinking Water

2014· erratum· en· W2028298716 on OpenAlexaff
Andrée F. Maheux, Ève Bérubé, Dominique K. Boudreau, Romain Villéger, Philippe Cantin, Maurice Boissinot, Luc Bissonnette, Michel G. Bergeron

Bibliographic record

VenueApplied and Environmental Microbiology · 2014
Typeerratum
Languageen
FieldBiochemistry, Genetics and Molecular Biology
TopicBacterial Identification and Susceptibility Testing
Canadian institutionsMinistère des Ressources naturelles et des ForêtsUniversité Laval
Fundersnot available
KeywordsClostridium perfringensMicrobiologySporeAgarClostridiaceaeClostridiumToxinAlpha (finance)BiologyChemistryBacteriaMedicineGenetics

Abstract

fetched live from OpenAlex

Volume 79, no. 24, p. 7654–7661, 2013. Page 7658, Table 4: The sequence of primer CpaTQ1 should read “CTAGATATGAATGGCAAAGAGGAAACTA

Fetched live from OpenAlex and de-inverted. Abstracts are not stored in this database: the inverted indexes are 8.6 GB of the frame’s 9.3 GB of text, and the host has 13 GB free.

How this classification was reachedexpand

Full frame distilled prediction

Teacher imitation

Not calibrated prevalence, not ground truth. Human validation pending. Learned from the 10,348 direct Codex labels and 10,348 direct Gemma labels. Candidate is the union of thresholded teacher heads; consensus is their intersection. These outputs are machine_predicted_unvalidated and are not human labels or direct frontier model labels.

metaresearch head score (Codex)0.001
metaresearch head score (Gemma)0.000
Version: codex-gemma-dda1882f352aValidation status: machine_predicted_unvalidated
Candidate categoriesMeta-epidemiology (narrow)
Consensus categoriesnone
DomainCandidate signal: none · Consensus signal: none
Study designCandidate signal: Bench or experimental · Consensus signal: none
GenreCandidate signal: Empirical · Consensus signal: Empirical
Teacher disagreement score0.466
Threshold uncertainty score1.000

Codex and Gemma teacher scores by category

CategoryCodexGemma
Metaresearch0.0010.000
Meta-epidemiology (narrow)0.0000.000
Meta-epidemiology (broad)0.0000.000
Bibliometrics0.0000.000
Science and technology studies0.0000.000
Scholarly communication0.0000.000
Open science0.0000.000
Research integrity0.0000.000
Insufficient payload (model declined to judge)0.0000.000

Machine scores (provisional)

The two teacher heads of the student model, read on this work. A score orders the frame for review; it never asserts a category, and the validation status ships verbatim with every row.

Baseline scores from an immature model (maturity gate not passed, 7 training rounds). Scores rank; they never assert a category.

Opus teacher head0.008
GPT teacher head0.222
Teacher spread0.214 · how far apart the two teachers sit on this one work
Validation statusscore_only:v0-immature-baseline · verbatim from the scoring run: score_only means the number may rank works, and no category label ships from it

Classification

machine, unvalidated

Machine predicted; a candidate call from one teacher head, not a consensus.

Study designBench or experimental
Domainnot available
GenreEmpirical

How this classification was reached, model by model and score by score, is at the end of the page under "How this classification was reached".

Quick stats

Citations0
Published2014
Admission routes1
Has abstractyes

Explore more

Same venueApplied and Environmental MicrobiologySame topicBacterial Identification and Susceptibility TestingFrench-language works237,207