MétaCan
Menu
Back to cohort
Record W2028298716 · doi:10.1128/aem.03147-14

Erratum for Maheux et al., Abilities of the mCP Agar Method and CRENAME Alpha Toxin-Specific Real-Time PCR Assay To Detect Clostridium perfringens Spores in Drinking Water

2014· erratum· en· W2028298716 on OpenAlexaff
Andrée F. Maheux, Ève Bérubé, Dominique K. Boudreau, Romain Villéger, Philippe Cantin, Maurice Boissinot, Luc Bissonnette, Michel G. Bergeron

Bibliographic record

VenueApplied and Environmental Microbiology · 2014
Typeerratum
Languageen
FieldBiochemistry, Genetics and Molecular Biology
TopicBacterial Identification and Susceptibility Testing
Canadian institutionsMinistère des Ressources naturelles et des ForêtsUniversité Laval
Fundersnot available
KeywordsClostridium perfringensMicrobiologySporeAgarClostridiaceaeClostridiumToxinAlpha (finance)BiologyChemistryBacteriaMedicineGenetics

Abstract

fetched live from OpenAlex

Volume 79, no. 24, p. 7654–7661, 2013. Page 7658, Table 4: The sequence of primer CpaTQ1 should read “CTAGATATGAATGGCAAAGAGGAAACTA

Fetched live from OpenAlex and de-inverted. Abstracts are not stored in this database: the inverted indexes are 8.6 GB of the frame’s 9.3 GB of text, and the host has 13 GB free.

How this classification was reachedexpand

Full frame machine prediction

Teacher imitation

Not calibrated prevalence, not ground truth. Human validation pending. The Gemma side is a direct model label for every work in the frame, read from the title-only record. The Codex side is a classifier learned from the 10,348 direct Codex labels and calibrated to design-weighted sample rates; fields without enough sample support carry no Codex call. Candidate is the union of the two sides; consensus is their intersection. These outputs are machine_predicted_unvalidated and are not human labels.

metaresearch head score (Codex)0.003
metaresearch head score (Gemma)0.022
Version: metacan-v3-hybrid-931329e0061cValidation status: machine_predicted_unvalidated
Candidate categoriesnone
Consensus categoriesnone
DomainCandidate signal: none · Consensus signal: none
Study designCandidate signal: Not applicable · Consensus signal: Not applicable
GenreCandidate signal: Other · Consensus signal: none
Teacher disagreement score0.034
Threshold uncertainty score0.113

Distilled classifier scores by category (both heads)

CategoryCodexGemma
Metaresearch0.0030.022
Meta-epidemiology (narrow)0.0020.002
Meta-epidemiology (broad)0.0020.001
Bibliometrics0.0040.002
Science and technology studies0.0030.002
Scholarly communication0.0030.002
Open science0.0030.001
Research integrity0.0050.007
Insufficient payload (model declined to judge)0.0340.043

Machine scores (provisional)

The two teacher heads of the student model, read on this work. A score orders the frame for review; it never asserts a category, and the validation status ships verbatim with every row.

Baseline scores from an immature model (maturity gate not passed, 7 training rounds). Scores rank; they never assert a category.

Opus teacher head0.008
GPT teacher head0.222
Teacher spread0.214 · how far apart the two teachers sit on this one work
Validation statusscore_only:v0-immature-baseline · verbatim from the scoring run: score_only means the number may rank works, and no category label ships from it

Classification

machine, unvalidated

Machine predicted; a candidate call from one source (direct Gemma or distilled Codex), not a consensus.

The models applied no category: nothing in the taxonomy fit this work.
Study designNot applicable
Domainnot available
GenreOther

How this classification was reached, model by model and score by score, is at the end of the page under "How this classification was reached".

Quick stats

Citations0
Published2014
Admission routes1
Has abstractyes

Explore more

Same venueApplied and Environmental MicrobiologySame topicBacterial Identification and Susceptibility TestingFrench-language works237,207