MétaCan
Menu
Back to cohort
Record W2073489209 · doi:10.1042/bj20041568

Role of <i>cis</i>-acting elements in the control of SERCA2b Ca2+ pump mRNA decay by nuclear proteins

2005· article· en· W2073489209 on OpenAlexafffund
Christine M. MISQUITTA, Paromita Ghosh, James Mwanjewe, Ashok K. Grover

Bibliographic record

VenueBiochemical Journal · 2005
Typearticle
Languageen
FieldBiochemistry, Genetics and Molecular Biology
TopicRNA Research and Splicing
Canadian institutionsMcMaster University
FundersHeart and Stroke Foundation of Canada
KeywordsRNABiologyMessenger RNARNA splicingBiophysicsBiochemistryCell biologyMolecular biologyGene

Abstract

fetched live from OpenAlex

Alternative splicing at position 3495 b yields SERCA2 (sarco/endoplasmic reticulum Ca2+ pump 2) RNA species, namely SERCA2a and SERCA2b which differ in 3'-end regions. This results in SERCA2b RNA being less stable. In vitro decay experiments show that, in the presence of protein extracts from nuclei of LVMs (left ventricular myocytes), the rate of decay of both SERCA2b RNA and synthetic RNA from its 3'-region is greater than that of the corresponding SERCA2a RNA. To search for cis-acting instability elements in the 3'-region of SERCA2b, we examined the effects of LVM nuclear protein extracts on the in vitro decay of six short overlapping capped [m7G(5')ppp(5')Gm] and polyadenylated (A40) RNA fragments from the 3'-end region (3444-4472) of SERCA2b. The proximal fragment 2B1 (3444-3753) was the most unstable. 2B1 RNA without a cap or a polyadenylated tail was analysed further in electrophoretic mobility-shift assays, and was observed to bind to protein(s) in the nuclear extracts. Based on competition for binding to nuclear proteins between radiolabelled 2B1 RNA and short unlabelled RNA fragments, the cis-acting element involved in this binding was the sequence 2B1-4. 2B1-4 is a 35-base (3521-3555, CCAGUCCUGCUCGUUGUGGGCGUGCACCGAGGGGG) GC-rich region just past the splice site (3495). Nuclear extracts decreased the electrophoretic mobility of the radiolabelled 2B1-4 RNA which bound to two proteins (19 and 21 kDa) in cross-linking experiments. Excess 2B1-4 RNA decreased the decay of the 2B1 RNA by the nuclear protein extract. 2B1-del 4 RNA (2B1 with the 2B1-4 domain deleted) also decayed more slowly than the control 2B1 RNA. Thus SERCA2b contains a novel GC-rich cis-acting element involved in its decay by nuclear proteins.

Fetched live from OpenAlex and de-inverted. Abstracts are not stored in this database: the inverted indexes are 8.6 GB of the frame’s 9.3 GB of text, and the host has 13 GB free.

How this classification was reachedexpand

Full frame machine prediction

Teacher imitation

Not calibrated prevalence, not ground truth. Human validation pending. The Gemma side is a direct model label for every work in the frame, read from the title-only record. The Codex side is a classifier learned from the 10,348 direct Codex labels and calibrated to design-weighted sample rates; fields without enough sample support carry no Codex call. Candidate is the union of the two sides; consensus is their intersection. These outputs are machine_predicted_unvalidated and are not human labels.

metaresearch head score (Codex)0.000
metaresearch head score (Gemma)0.000
Version: metacan-v3-hybrid-931329e0061cValidation status: machine_predicted_unvalidated
Candidate categoriesnone
Consensus categoriesnone
DomainCandidate signal: none · Consensus signal: none
Study designCandidate signal: Bench or experimental · Consensus signal: Bench or experimental
GenreCandidate signal: Empirical · Consensus signal: Empirical
Teacher disagreement score0.002
Threshold uncertainty score0.006

Distilled classifier scores by category (both heads)

CategoryCodexGemma
Metaresearch0.0000.000
Meta-epidemiology (narrow)0.0010.000
Meta-epidemiology (broad)0.0000.000
Bibliometrics0.0000.000
Science and technology studies0.0000.000
Scholarly communication0.0010.000
Open science0.0000.000
Research integrity0.0000.001
Insufficient payload (model declined to judge)0.0020.001

Machine scores (provisional)

The two teacher heads of the student model, read on this work. A score orders the frame for review; it never asserts a category, and the validation status ships verbatim with every row.

Baseline scores from an immature model (maturity gate not passed, 7 training rounds). Scores rank; they never assert a category.

Opus teacher head0.007
GPT teacher head0.254
Teacher spread0.248 · how far apart the two teachers sit on this one work
Validation statusscore_only:v0-immature-baseline · verbatim from the scoring run: score_only means the number may rank works, and no category label ships from it

Classification

machine, unvalidated

Machine predicted; a candidate call from one source (direct Gemma or distilled Codex), not a consensus.

The models applied no category: nothing in the taxonomy fit this work.
Study designBench or experimental
Domainnot available
GenreEmpirical

How this classification was reached, model by model and score by score, is at the end of the page under "How this classification was reached".

Quick stats

Citations7
Published2005
Admission routes2
Has abstractyes

Explore more

Same venueBiochemical JournalSame topicRNA Research and SplicingFrench-language works237,207