MétaCan
Menu
Back to cohort
Record W2078805655 · doi:10.1094/pdis-93-10-1073a

First Report of <i>Cherry green ring mottle virus</i> in Plum (<i>Prunus domestica</i>) in North America

2009· article· en· W2078805655 on OpenAlexaffabout
L. P. Wang, Ní Hóng, G. P. Wang, R. Michelutti, B. L. Zhang

Bibliographic record

VenuePlant Disease · 2009
Typearticle
Languageen
FieldAgricultural and Biological Sciences
TopicPlant Virus Research Studies
Canadian institutionsAgriculture and Agri-Food Canada
Fundersnot available
KeywordsPrunusBiologyPrunus cerasusSour cherryPrunus armeniacaHorticultureBotanyPlant virusCultivarInoculationVirus

Abstract

fetched live from OpenAlex

Cherry green ring mottle virus (CGRMV), a member of the genus Foveavirus, is reported to infect several Prunus species including sour cherry (Prunus cerasus L.), sweet cherry (P. avium L.), flowering cherry (P. serrulata L.), peach (P. persica B.), and apricot (P. armeniaca L.). The virus has been detected in most regions of North America, Europe, New Zealand, Africa, and Japan where Prunus species are grown for production (3). In sour cherry, the virus causes leaf yellowing and dark mottle around secondary veins. Other Prunus species are usually symptomless hosts of CGRMV. There is no report on the infection of CGRMV in plum so far. A survey was conducted to evaluate the sanitary status of stone fruit tree collections in the Canadian Clonal Genebank (CCG) at the Greenhouse and Processing Crops Research Center (GPCRC) in Harrow, Ontario (Canada). In October 2006, samples from 110 cultivar clones including 28 sweet cherry, 36 sour cherry, 12 hybrids, and 34 plum accessions, were bud grafted onto indicator seedlings of P. serrulata 'Kwanzan' for virus indexing in a greenhouse with a controlled environment. In April 2007, symptoms of epinasty and/or rusty necrotic fragments of midrib, which is indicative of Kwanzan infection by CGRMV (4), were observed on indicator plants inoculated with samples from eight clones (one sweet cherry, one cherry plum (P. besseyi × P. hortulana) and six plum). Indicator plants inoculated with samples from 19 other clones (three sweet cherry, nine sour cherry, one cherry plum and six plum) showed symptoms including small leaves and leaves that were twisted, deformed, bubbled, and/or had shot holes. Total RNA was extracted from leaves of all these symptomatic indicator plants by the cetyltrimethylammoniumbromide (CTAB) method (2). One-step reverse transcription (RT)-PCR was carried out using the primer set CGRMV1 (CCTCATTCACATAGCTTAGGTTT, 7,297 to 7,313 bp) and CGRMV2 (ACTTTAGCTTCGCCCCGTG, 8,245 to 8,227 bp) (1) for the detection of CGRMV. Amplicons of the expected size of 948 bp were consistently produced from eight samples showing symptoms of CGRMV infection, no amplicons were produced from the other 19 samples. Those results were further confirmed by RT-PCR detection for the original field samples. The fragment from plum cv. Vanier was cloned into pGEM-T Easy and sequenced in both directions of three clones. The resulting nucleotide sequence (GenBank Accession No. FJ402843) had the highest identity (97%) with that of a CGRMV isolate Star from sweet cherry (GenBank Accession No. AY841279) and had lower identity (81%) with that of a CGRMV isolate from apricot (GenBank Accession No. AY172334.1). To our knowledge, this is the first report of CGRMV infecting plum in North America. References: (1) R. Li and R. Mock. J. Virol. Methods 129:162, 2005. (2) R. Li et al. Plant Dis. 88:12, 2004. (3) K. G. Parker et al. USDA Agric. Handb. No. 437:193, 1976. (4) Y. Zhang et al. J. Gen. Virol. 79:2275, 1998.

Fetched live from OpenAlex and de-inverted. Abstracts are not stored in this database: the inverted indexes are 8.6 GB of the frame’s 9.3 GB of text, and the host has 13 GB free.

How this classification was reachedexpand

Full frame machine prediction

Teacher imitation

Not calibrated prevalence, not ground truth. Human validation pending. The Gemma side is a direct model label for every work in the frame, read from the title-only record. The Codex side is a classifier learned from the 10,348 direct Codex labels and calibrated to design-weighted sample rates; fields without enough sample support carry no Codex call. Candidate is the union of the two sides; consensus is their intersection. These outputs are machine_predicted_unvalidated and are not human labels.

metaresearch head score (Codex)0.000
metaresearch head score (Gemma)0.000
Version: metacan-v3-hybrid-931329e0061cValidation status: machine_predicted_unvalidated
Candidate categoriesnone
Consensus categoriesnone
DomainCandidate signal: none · Consensus signal: none
Study designCandidate signal: Case report · Consensus signal: none
GenreCandidate signal: Empirical · Consensus signal: Empirical
Teacher disagreement score0.010
Threshold uncertainty score0.021

Distilled classifier scores by category (both heads)

CategoryCodexGemma
Metaresearch0.0000.000
Meta-epidemiology (narrow)0.0000.000
Meta-epidemiology (broad)0.0000.000
Bibliometrics0.0000.000
Science and technology studies0.0010.000
Scholarly communication0.0010.000
Open science0.0000.000
Research integrity0.0000.000
Insufficient payload (model declined to judge)0.0010.000

Machine scores (provisional)

The two teacher heads of the student model, read on this work. A score orders the frame for review; it never asserts a category, and the validation status ships verbatim with every row.

Baseline scores from an immature model (maturity gate not passed, 7 training rounds). Scores rank; they never assert a category.

Opus teacher head0.022
GPT teacher head0.240
Teacher spread0.218 · how far apart the two teachers sit on this one work
Validation statusscore_only:v0-immature-baseline · verbatim from the scoring run: score_only means the number may rank works, and no category label ships from it

Classification

machine, unvalidated

Machine predicted; a candidate call from one source (direct Gemma or distilled Codex), not a consensus.

The models applied no category: nothing in the taxonomy fit this work.
Study designCase report
Domainnot available
GenreEmpirical

How this classification was reached, model by model and score by score, is at the end of the page under "How this classification was reached".

Quick stats

Citations6
Published2009
Admission routes2
Has abstractyes

Explore more

Same venuePlant DiseaseSame topicPlant Virus Research StudiesFrench-language works237,207