Crystal Structure of Norwalk Virus Polymerase Reveals the Carboxyl Terminus in the Active Site Cleft

Norwalk virus is a major cause of acute gastroenteritis for which effective treatments are sorely lacking. To provide a basis for the rational design of novel antiviral agents, the main replication enzyme in Norwalk virus, the virally encoded RNA-dependent RNA polymerase (RdRP), has been expressed in an enzymatically active form, and its structure has been crystallographically determined both in the presence and absence of divalent metal cations. Although the overall fold of the enzyme is similar to that seen previously in the RdRP from rabbit hemorrhagic disease virus, the carboxyl terminus, surprisingly, is located in the active site cleft in five independent copies of the protein in three distinct crystal forms. The location of this carboxyl-terminal segment appears to interfere with the binding of double-stranded RNA in the active site cleft and may play a role in the initiation of RNA synthesis or mediate interactions with accessory replication proteins. Norwalk virus is a major cause of acute gastroenteritis for which effective treatments are sorely lacking. To provide a basis for the rational design of novel antiviral agents, the main replication enzyme in Norwalk virus, the virally encoded RNA-dependent RNA polymerase (RdRP), has been expressed in an enzymatically active form, and its structure has been crystallographically determined both in the presence and absence of divalent metal cations. Although the overall fold of the enzyme is similar to that seen previously in the RdRP from rabbit hemorrhagic disease virus, the carboxyl terminus, surprisingly, is located in the active site cleft in five independent copies of the protein in three distinct crystal forms. The location of this carboxyl-terminal segment appears to interfere with the binding of double-stranded RNA in the active site cleft and may play a role in the initiation of RNA synthesis or mediate interactions with accessory replication proteins. Recent studies have shown that members of the Norovirus genus within the Caliciviridae family are now considered one of the most common causes of outbreaks and sporadic cases of gastroenteritis in individuals of all ages worldwide (1Koopmans M. Duizer E. Int. J. Food Microbiol. 2004; 90: 23-41Crossref PubMed Scopus (555) Google Scholar). These pathogens have a positive-strand RNA genome and life cycle that are similar in many respects to a group of evolutionarily related viruses responsible for important human diseases such as polio, hepatitis C, dengue, yellow fever, viral encephalitis (West Nile virus and Japanese encephalitis virus), and severe acute respiratory syndrome. Many of these viruses are threats to public health, because they are highly infectious and can cause serious illnesses, in some cases leading to death. The limitations of vaccination and lack of effective antiviral chemotherapeutics for many of these diseases underline the urgency of understanding positive-stranded RNA viruses at a deeper, molecular level to allow for the development of novel treatments. Replication of the genome in all positive-strand RNA viruses is critically dependent on the activity of a virally encoded RNA-dependent RNA polymerase (RdRP) 1The abbreviations used are: RdRP, RNA-dependent RNA polymerase; HCV, hepatitis C virus; PV, polio virus; RHDV, rabbit hemorrhagic disease virus; NV, Norwalk virus; CHAPS, 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonic acid. 1The abbreviations used are: RdRP, RNA-dependent RNA polymerase; HCV, hepatitis C virus; PV, polio virus; RHDV, rabbit hemorrhagic disease virus; NV, Norwalk virus; CHAPS, 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonic acid. (2O'Reilly E.K. Kao C.C. Virology. 1998; 252: 287-303Crossref PubMed Scopus (258) Google Scholar). This enzyme is responsible for synthesizing negative-sense RNA, which is complementary to the positive-sense genomic RNA, as well as newly made positive-sense RNA genomes that can be used for the production of viral proteins or packaged into new viral particles. The three-dimensional structures of RdRPs from members of three families of positive-strand RNA viruses (poliovirus (PV) (3Hansen J.L. Long A.M. Schultz S.C. Structure. 1997; 5: 1109-1122Abstract Full Text Full Text PDF PubMed Scopus (379) Google Scholar) from Picornaviridae, hepatitis C virus (HCV) (4Ago H. Adachi T. Yoshida A. Yamamoto M. Habuka N. Yatsunami K. Miyano M. Structure Fold. Des. 1999; 7: 1417-1426Abstract Full Text Full Text PDF Scopus (387) Google Scholar, 5Bressanelli S. Tomei L. Roussel A. Incitti I. Vitale R.L. Mathieu M. De Francesco R. Rey F.A. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 13034-13039Crossref PubMed Scopus (542) Google Scholar, 6Lesburg C.A. Cable M.B. Ferrari E. Hong Z. Mannarino A.F. Weber P.C. Nat. Struct. Biol. 1999; 6: 937-943Crossref PubMed Scopus (689) Google Scholar) from Flaviviridae, and rabbit hemorrhagic disease virus (RHDV) (7Ng K.K. Cherney M.M. Vazquez A.L. Machin A. Alonso J.M. Parra F. James M.N. J. Biol. Chem. 2002; 277: 1381-1387Abstract Full Text Full Text PDF PubMed Scopus (140) Google Scholar) from Caliciviridae) have previously revealed a similar overall architecture as well as a range of specific adaptations (8Bruenn J.A. Nucleic Acids Res. 2003; 31: 1821-1829Crossref PubMed Scopus (215) Google Scholar). Here, we report the novel structure of an RdRP from a genogroup II Norwalk virus (NV) isolate, Ast6139/01/Sp, in a metal-free form at 2.17 Å resolution, as well as in a metal-bound form at 2.95 Å resolution. Although the arrangement of secondary structural elements and key catalytic motifs is similar to those seen in the RHDV enzyme as well as other RdRPs from positive-strand RNA viruses, dramatic structural differences, especially in the carboxyl-terminal region, suggest novel functional adaptations important for viral replication. A small metal-dependent conformational change can also be seen when comparing the structure of the metal-free NV RdRP in two crystal forms with the structure of the metal-bound enzyme in a third crystal form. These structures represent the first three-dimensional structures of a Norovirus enzyme and provide the basis for the structure-based design of antiviral therapeutics against an important group of human pathogens. Construction of the RdRP Expression Vector—The NV RdRP coding region was amplified by PCR using a cDNA clone (GenBank™ accession number AJ583672) from the Spanish NV isolate Ast6139/01/Sp and the specific primers NVpol5B ggatccgacagtaagggaacatactg and NVpol3E gaattctcattcgacgccatcttcattc, which also added BamHI and EcoRI restriction enzyme recognition sequences (underlined residues) at both ends of the amplified region. The resulting fragment was first ligated to pGEM-T vector (Promega), and then, after digestion with the restriction enzymes BamHI and EcoRI, the 1.5-kb fragment containing the RdRP gene was purified and inserted into BamHI-EcoRI-digested, alkaline phosphatase-treated pGEX-2T (Amersham Biosciences) to generate the recombinant expression vector pGEX-NV-3D. This recombinant plasmid was designed to produce the NV RdRP as a fusion protein with Schistosoma japonicum glutathione S-transferase at the amino terminus. Protein Expression and Purification—Overnight cultures of Escherichia coli XL-1 Blue transformed with pGEX-NV-3D were diluted 1:250 in 500 ml of Luria-Bertani medium containing ampicillin (50 μg ml-1). The cultures were incubated at 37 °C to an A600 of 0.5, and isopropyl-thio-β-d-galactopyranoside was added up to 200 μm. After 2 h of growth at 37 °C, the cells were harvested by centrifugation, and the pellet was suspended in 30 ml of 50 mm Tris-HCl (pH 8.0), 150 mm NaCl, 0.25 mm EDTA (Buffer 1). The suspension was sonicated, and the supernatant, recovered after centrifugation at 15,000 rpm for 30 min in a Sorvall SS-34 rotor, was loaded onto a 5-ml glutathione-Sepharose 4B column (Amersham Biosciences) equilibrated in Buffer 1. The eluate was retained and reapplied to the column. Following the absorption step, the column was washed five times with 5 ml of Buffer 1. After the final wash, the gel slurry was suspended in 400 μl of Buffer 1 containing 480 ng of thrombin (Amersham Biosciences) and incubated at room temperature for 3 h. NV RdRP was recovered from the eluate and further purified by ion exchange chromatography using a Vivapure Q Maxi H spin column (Vivascience). The purified protein was eluted with a step gradient of Buffer 1 containing 200, 250, and 300 mm NaCl. The salt and buffer concentration were lowered to 50 mm NaCl and 10 mm Tris-Cl, pH 8.0, by dilution, and the protein was concentrated to 7 mg/ml using an Ultrafree-15 BioMax 10-kDa centrifugal spin filter (Millipore). Approximately 3-4 mg of purified protein was obtained from 1 liter of bacterial cell culture. Preparation of Synthetic NV Heteropolymeric RNA—A cDNA clone containing the NV Ast6139/01/Sp 3′ sequence was PCR-amplified using oligonucleotide primers NV5 (taatacgactcactatagtagctcacactggcccg) and NVdT3 (tttttttttttttttttaaagacactaaag). The 1013-bp PCR product containing a minimal T7 RNA polymerase promoter (underlined residues) was phenol-chloroform-extracted, ethanol-precipitated, and dissolved in diethyl pyrocarbonate-treated water prior to its in vitro transcription using the large scale RNA production system Ribomax (Promega). Enzymatic Assays—RdRP activity was assayed in 50-μl samples containing 4 μg of the purified enzyme, 50 mm HEPES (pH 8.0), 10 μm ATP, 10 μm GTP, 10 μm CTP, 5 μm UTP, 4 mm dithiothreitol, 50 units of ribonuclease inhibitor (Promega), 25 μmol (10 μCi) of [α32-P]UTP, 60 nm synthetic NV heteropolymeric RNA, and 0.1-5 mm magnesium acetate. After incubation at 30 °C for 60 min, the reaction mixture was phenol-chloroform-extracted and then ethanol-precipitated in the presence of 0.3 m sodium acetate (pH 6.0) and 20 μg of carrier tRNA. The sediments were dissolved in electrophoresis sample buffer, loaded onto 1.2% formaldehyde-agarose gels, and electrophoresed at 60-70 V. The gels were then dried and the in vitro32P-labeled RNA products detected by autoradiography. Crystallization—Crystals were grown at room temperature by the hanging drop vapor diffusion method by mixing 2 μl of NV polymerase (7 mg/ml) and 2 μl of 24% (w/v) polyethylene glycol 8000, 100-200 mm ammonium sulfate, 50 mm Tris-Cl, pH 7.5, 15% (w/v) glycerol, 0.2% (w/v) CHAPS, and 14 mm 2-mercaptoethanol. At least two different crystal forms (space groups C2221 and P1) with similar morphologies grew to a maximum of mm after crystal form (space group be grown to a of mm similar with the mm ammonium and 20 mm magnesium Structure and were on at by from the into a were from a using from a and were and using the of Z. 1997; Scopus Google Scholar). were to using 4 Biol. PubMed Scopus Google Scholar). The of the was to be one of NV polymerase was in the The structure of RHDV polymerase with all and temperature was used as the for molecular were using Biol. PubMed Scopus Google Scholar). The and both a of and The crystal the was of using the J. M. T. Biol. 1998; PubMed Scopus Google using Biol. PubMed Scopus Google and using J. Struct. Biol. 1999; PubMed Scopus Google Scholar) for the of a with At this the crystal form with two copies in the was This crystal a and were using the that been in the crystal form. in both the and and the was for the crystal form. and using further and the structures of both copies in the were using and using M.N. Biol. PubMed Scopus Google Scholar) for and temperature Following the of the of the protein was onto the in the crystal form, and was on this crystal form as using the from the crystal form also two for the crystal form grown in the presence of 20 mm magnesium This structure was and as of the of these to were The final in all three crystal forms with the five and three carboxyl-terminal in all five independent of the in the most of the and are in by A.L. J.M. PubMed Scopus Google on were using PubMed Scopus Google Scholar). and are in I. were with J. Google J. 1997; PubMed Scopus Google M. 1997; 277: PubMed Scopus Google and J.M. Protein PubMed Scopus Google cell cell for the are in for the are in for the are in for the are in for the are in for the are in is the of a and is the of all of for the of used in for the of from of or from as by as by as by for the are in is the of a and is the of all of for the of used in for the of from as by M.N. Biol. PubMed Scopus Google Scholar). in a new Expression and Enzymatic of NV expressed form of NV RdRP used in this is in sequence to the form of the enzyme, as from studies of in other NV J. 1999; PubMed Scopus Google Scholar, A. Virology. 2003; PubMed Scopus Google Scholar, T. M. J. 2003; PubMed Scopus Google that at the from the amino terminus. The RNA-dependent RNA polymerase activity with the purified recombinant protein was assayed using a synthetic RNA from a cDNA of the 3′ region of the genome of the Ast6139/01/Sp isolate a of The major product was 2 in the of the RNA The in to the a synthesis reaction similar to that seen previously in RHDV A. Alonso J.M. R. J.A. Parra F. J. 1998; PubMed Google Scholar) and J. PubMed Google Scholar, E. J. PubMed Google Scholar, J. PubMed Google Scholar). as seen in RdRPs from RHDV A. Alonso J.M. Parra F. PubMed Scopus Google E. of and many other viruses, the polymerase activity was dependent on the presence of divalent this in the incubation Structure of NV crystal structure of NV RdRP has been determined in three different crystal forms using the molecular method with RHDV RdRP (7Ng K.K. Cherney M.M. Vazquez A.L. Machin A. Alonso J.M. Parra F. James M.N. J. Biol. Chem. 2002; 277: 1381-1387Abstract Full Text Full Text PDF PubMed Scopus (140) Google Scholar) as the Although all three crystal forms were grown similar with polyethylene glycol as the the molecular and group in the three crystal forms crystal forms were grown in the absence of divalent metal and the third crystal form was grown in the presence of 20 mm magnesium The overall structure of NV RdRP can be using an to a which is for a range of 1). to the and common to all NV RdRP has an the and as seen in all other RdRPs of three-dimensional structure (8Bruenn J.A. Nucleic Acids Res. 2003; 31: 1821-1829Crossref PubMed Scopus (215) Google Scholar). are by with the of at the amino and at the carboxyl terminus. The carboxyl-terminal region is of as and is to that the three are in all three crystal forms. The of three crystal forms of NV RdRP five independent copies in distinct crystal The crystal in of the three crystal forms is the in the the active site as in of related by a and crystal or crystal The of these are and for the and crystal an similar in to important H. K. J.M. PubMed Scopus Google Scholar). A common of all three is a of of and well in the well in other is important to that this and is in the RHDV RdRP crystal and this from the to be of functional in H. T. N. T. S. J. Biol. Chem. 2002; 277: Full Text Full Text PDF PubMed Scopus Google Scholar, K. J. S. F. R. K. J.M. J. 2002; PubMed Scopus Google Scholar) and (3Hansen J.L. Long A.M. Schultz S.C. Structure. 1997; 5: 1109-1122Abstract Full Text Full Text PDF PubMed Scopus (379) Google Scholar, Schultz S.C. K. Google Scholar, K. K. Schultz S.C. J. PubMed Scopus Google Scholar) Although the functional of the resulting NV RdRP is from the the location of this the of the active site cleft that interactions important for RNA binding or RNA synthesis may be by this with RHDV RdRP and overall fold of the RdRP enzymes from RHDV and NV is are many of structural can be Å with a of Å A structure-based sequence amino or an overall sequence of 24% the two proteins. The key motifs by a of sequence and structural in RdRPs are well in both the RHDV and NV which is with the of these in the structural and of RdRPs (8Bruenn J.A. Nucleic Acids Res. 2003; 31: 1821-1829Crossref PubMed Scopus (215) Google Scholar). copies of metal-free NV RdRP have been and to 2.17 and Å in two different crystal forms. The of two of these structures and the two copies of the form of the enzyme to 2.95 Å of and Å when with the structures of the metal-free The of the enzyme, of the of the and of the and the of conformational the region, in the and and of the the of conformational is the conformational seen in of the to the divalent metal binding This the by and and the active and conformational in this region may be of functional appears to be a common of many and a large of the presence of conformational in RHDV (7Ng K.K. Cherney M.M. Vazquez A.L. Machin A. Alonso J.M. Parra F. James M.N. J. Biol. Chem. 2002; 277: 1381-1387Abstract Full Text Full Text PDF PubMed Scopus (140) Google Scholar) and RdRPs L. S. Kao C.C. J. 2002; PubMed Scopus Google Scholar, I. S. M. J. Biol. Chem. 2003; Full Text Full Text PDF PubMed Scopus Google Scholar, I. M. J. Biol. Chem. 2003; Full Text Full Text PDF PubMed Scopus Google as well as related S. J. 1998; PubMed Scopus Google Scholar, K. J. E. Chem. Biol. 1999; 6: Full Text PDF PubMed Scopus Google Scholar, S. T. Structure Fold. Des. 1999; 7: Full Text Full Text PDF Scopus Google Scholar, T. J. Biol. PubMed Scopus Google Scholar). both copies of NV RdRP in the a magnesium ion is to one of the of and is to the group of This appears similar to that seen in the metal-bound form of RHDV RdRP (7Ng K.K. Cherney M.M. Vazquez A.L. Machin A. Alonso J.M. Parra F. James M.N. J. Biol. Chem. 2002; 277: 1381-1387Abstract Full Text Full Text PDF PubMed Scopus (140) Google as well as in the RdRP (3Hansen J.L. Long A.M. Schultz S.C. Structure. 1997; 5: 1109-1122Abstract Full Text Full Text PDF PubMed Scopus (379) Google Scholar). be that this form is similar to metal-free NV RdRP the metal-bound form of RHDV RdRP, which the for the reaction RNA synthesis (7Ng K.K. Cherney M.M. Vazquez A.L. Machin A. Alonso J.M. Parra F. James M.N. J. Biol. Chem. 2002; 277: 1381-1387Abstract Full Text Full Text PDF PubMed Scopus (140) Google Scholar, E. of Scholar). is that the metal-bound forms of NV and RHDV RdRPs represent well of the enzyme when RNA is The enzyme in the presence of and RNA the structures are to be similar to the metal-bound seen in RHDV Structure and of the of the NV RdRP structures is the location of the carboxyl in the active site cleft the catalytic This segment with the of the active site cleft by the is well to and conformational The from to is well by has temperature most of the of the protein are well to be they to some of the in the active site cleft the active site Although the location of this carboxyl-terminal fragment in the active site cleft is of the carboxyl-terminal and in RdRP J.M. PubMed Scopus Google as well as the carboxyl-terminal segment and in the of RdRP (4Ago H. Adachi T. Yoshida A. Yamamoto M. Habuka N. Yatsunami K. Miyano M. Structure Fold. Des. 1999; 7: 1417-1426Abstract Full Text Full Text PDF Scopus (387) Google Scholar, 5Bressanelli S. Tomei L. Roussel A. Incitti I. Vitale R.L. Mathieu M. De Francesco R. Rey F.A. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 13034-13039Crossref PubMed Scopus (542) Google Scholar, 6Lesburg C.A. Cable M.B. Ferrari E. Hong Z. Mannarino A.F. Weber P.C. Nat. Struct. Biol. 1999; 6: 937-943Crossref PubMed Scopus (689) Google Scholar, T. H. Habuka N. K. M. S. Yatsunami K. 2002; PubMed Scopus Google Scholar, S. J. F. J. 2003; PubMed Scopus Google Scholar) both the and of the active site cleft and to primers for the initiation of RNA synthesis L. S. Kao C.C. J. 2002; PubMed Scopus Google Scholar, Ferrari E. C.A. Hong Z. J. PubMed Scopus Google Scholar, Z. N. Virology. PubMed Scopus Google Scholar, J. Biol. Chem. 2002; 277: Full Text Full Text PDF PubMed Scopus Google Scholar, R. J. J. Biol. 2003; PubMed Scopus (140) Google Scholar, L. Kao C.C. J. Biol. 2003; PubMed Scopus Google Scholar). be that the C of all forms of RdRP are the protein at different from the segment the polymerase the carboxyl in the NV RdRP structure is the from studies J. 1999; PubMed Scopus Google Scholar, A. Virology. 2003; PubMed Scopus Google Scholar, T. M. J. 2003; PubMed Scopus Google Scholar). the structural NV, HCV, and RdRPs suggest that the carboxyl-terminal segment in NV RdRP may also play a role in RNA replication. The location of the carboxyl-terminal sequence in the active site of NV RdRP appears to the of an RNA the carboxyl-terminal segment containing is from the NV polymerase a segment of RNA can be to into the active site cleft by the of the of the human H. R. S.C. 1998; PubMed Scopus Google Scholar) onto of the NV polymerase structure previously for RHDV polymerase (7Ng K.K. Cherney M.M. Vazquez A.L. Machin A. Alonso J.M. Parra F. James M.N. J. Biol. Chem. 2002; 277: 1381-1387Abstract Full Text Full Text PDF PubMed Scopus (140) Google The presence of the carboxyl-terminal segment with the of the of an RNA into the active site is well to with or primers or with structures the active site of the carboxyl-terminal sequences from Norovirus a of sequence in the carboxyl-terminal region, that a similar structure is in both of A of sequence in this region of RdRPs from other as well as the lack of structural the 25 of the NV and RHDV that the structure of the carboxyl in from these The three-dimensional structure of NV RdRP an overall architecture common to a range of as well as a structure in which the carboxyl of the protein in the active site Although the structure of NV RdRP is the first to the carboxyl of a polymerase in the active site is that the carboxyl-terminal sequence in the RHDV and RdRP crystal as well as the structures of RdRPs from many related and the of the active site The location of the carboxyl-terminal segment in this region of the enzyme may allow this segment of the protein to play a role in the initiation of RNA synthesis the structural of this region may in different The presence of 3 and at the carboxyl of the NV and RHDV RdRP crystal structures that these may a range of in these well when with other of the replication such as RNA, and protein the protein A. Alonso J.M. Parra F. J. Biol. Chem. Full Text Full Text PDF PubMed Scopus Google Scholar). To the role of the carboxyl-terminal sequence in RdRPs from different viruses, may also be important to that in the of the viral are also to to different forms of at different of the viral life a fusion appears to be the main form of active polymerase in A. A. M. T. E. J. 2002; PubMed Scopus Google Scholar) and may also be an important form of the polymerase in T. M. J. 2003; PubMed Scopus Google Scholar) and A similar fusion with that are distinct from the forms of both the and polymerase is also in the T. E. J. PubMed Google Scholar). Although the structure of this fusion is the presence of the is to the activity of the polymerase and the carboxyl-terminal segment may also play a role in this the for the presence of the in the fusion protein the activity of the polymerase L. A. J. PubMed Scopus Google Scholar). be of to to the carboxyl-terminal sequence in the RdRPs from and other viruses the activity of the fusion protein by interactions the and polymerase studies are to the of carboxyl-terminal in RdRPs from and other positive-strand RNA the role of this carboxyl-terminal segment in viral replication be important for the design of structure-based therapeutics against and other positive-strand RNA viruses in human that interactions the carboxyl-terminal segment and the active site cleft may interfere with viral replication and as effective antiviral for on the

Fetched live from OpenAlex and de-inverted. Abstracts are not stored in this database: the inverted indexes are 8.6 GB of the frame’s 9.3 GB of text, and the host has 13 GB free.