MétaCan
Menu
Back to cohort
Record W2261658698

MicroRNAs in the Developing Ovine Kidney

2013· article· en· W2261658698 on OpenAlexaffvenue
Michelle Tran Au

Bibliographic record

VenueJournal of undergraduate research in Alberta · 2013
Typearticle
Languageen
FieldBiochemistry, Genetics and Molecular Biology
TopicRenal and related cancers
Canadian institutionsUniversity of Calgary
Fundersnot available
KeywordsKidneyAcute kidney injurymicroRNABiologyRenal functionGeneKidney diseaseInternal medicineBioinformaticsMedicineEndocrinologyGenetics
DOInot available

Abstract

fetched live from OpenAlex

INTRODUCTION The sudden loss of kidney function is known as acute kidney injury (AKI), and is referred to as pediatric AKI or pAKI in the neonate, infant, and child. Characterized clinically by a decrease in kidney filtration that can usually be reversed, as well as the inability of the kidney to appropriately regulate fluid and electrolyte homeostasis [1,2], pAKI can lead to serious complications in kidney function later in life, known as chronic kidney disease (CKD). To date, underlying factors involved in the etiology of pAKI are not known. MicroRNAs (miRNAs) are a class of functional single stranded non-coding, small ribonucleic acid molecules [3]. These post-transcriptional regulators modify the expression of genes by acting on the mRNA that is transcribed from a gene (or multiple mRNAs), and thus, affect the translation of encoded protein [3,4]. miRNAs have been implicated in the etiology of AKI in adult animals, but their role in pAKI is not known. This preliminary research aims to determine potential regulatory genes targeted by miRNAs in the developing ovine kidney, and to explore whether any of these genes are altered in an experimental model of pAKI.METHODSAnimals used were Ovies aries (sheep, ~15 to 20 days postnatal, sacrificed). Kidney tissues were harvested and snap frozen. Two tissues were evaluated: AKI [Treated with lipopolysaccharide (0.03 mg/kg) and Indomethacin (1 mg/kg)] and Control (Untreated). miRNA was extracted from both tissues using the mirVana miRNA Isolation Kit. Samples were sequenced in the ACHRI Genomes Facility. Using MicroCosm Targets genes/miRNAs were evaluated and plotted using Microsoft Excel. After generation of all genes, those with ≥1.5 fold change (AKI vs. Control) were selected for analyses.  RESULTSA total of 103 miRNAs were present in Control and AKI tissue, in which the number of down-regulated genes (n=74) far exceeded the number up-regulated (n=27). A greater number of down-regulated genes exhibited ≥1.5-fold, ≥2.0-fold and ≥3.0 fold changes as compared to up-regulated genes. Oar-miR-380-3p_st (GGUGGAUAUUCCUUCUAUGUUU, fold-change = -2.1521) was found to be down-regulating the expression of cyclo-oxygenase (COX1, COX7C) and nitric oxide  (NOX1) genes. Table 1. MicroRNAs measured in ovine renal tissue. The number of genes down-regulated, up-regulated, and unchanged are shown as fold-change in AKI as compared to Control tissue. SUMMARY AND CONCLUSIONSThere were notable changes in miRNAs in AKI compared to Control tissue. Substantially fewer up-regulated genes than down-regulated genes, including COX1, COX7C, and NOX1 genes were observed (Table 1). Target genes within the COX and NOX pathways which are known to modulate kidney haemodynamics and function may reveal their altered roles in AKI.  Given the evolutionary conservation of miRNA regulatory circuits [4,5], a subset of candidate miRNAs in ovine tissue could be identified and validated for application to pAKI in future studies. Through the successful application of miRNA analyses to establish regulatory genes in ovine kidney tissue, we may further our understanding of the causes and consequences of pAKI, the deleterious effects of pAKI on kidney function, and the progression from pAKI to CKD.

Fetched live from OpenAlex and de-inverted. Abstracts are not stored in this database: the inverted indexes are 8.6 GB of the frame’s 9.3 GB of text, and the host has 13 GB free.

How this classification was reachedexpand

Full frame machine prediction

Teacher imitation

Not calibrated prevalence, not ground truth. Human validation pending. The Gemma side is a direct model label for every work in the frame, read from the title-only record. The Codex side is a classifier learned from the 10,348 direct Codex labels and calibrated to design-weighted sample rates; fields without enough sample support carry no Codex call. Candidate is the union of the two sides; consensus is their intersection. These outputs are machine_predicted_unvalidated and are not human labels.

metaresearch head score (Codex)0.000
metaresearch head score (Gemma)0.000
Version: metacan-v3-hybrid-931329e0061cValidation status: machine_predicted_unvalidated
Candidate categoriesnone
Consensus categoriesnone
DomainCandidate signal: none · Consensus signal: none
Study designCandidate signal: Bench or experimental · Consensus signal: Bench or experimental
GenreCandidate signal: Empirical · Consensus signal: Empirical
Teacher disagreement score0.002
Threshold uncertainty score0.006

Distilled classifier scores by category (both heads)

CategoryCodexGemma
Metaresearch0.0000.000
Meta-epidemiology (narrow)0.0000.000
Meta-epidemiology (broad)0.0000.000
Bibliometrics0.0000.000
Science and technology studies0.0000.000
Scholarly communication0.0000.000
Open science0.0000.000
Research integrity0.0000.000
Insufficient payload (model declined to judge)0.0020.000

Machine scores (provisional)

The two teacher heads of the student model, read on this work. A score orders the frame for review; it never asserts a category, and the validation status ships verbatim with every row.

Baseline scores from an immature model (maturity gate not passed, 7 training rounds). Scores rank; they never assert a category.

Opus teacher head0.031
GPT teacher head0.331
Teacher spread0.300 · how far apart the two teachers sit on this one work
Validation statusscore_only:v0-immature-baseline · verbatim from the scoring run: score_only means the number may rank works, and no category label ships from it

Classification

machine, unvalidated

Machine predicted; a candidate call from one source (direct Gemma or distilled Codex), not a consensus.

The models applied no category: nothing in the taxonomy fit this work.
Study designBench or experimental
Domainnot available
GenreEmpirical

How this classification was reached, model by model and score by score, is at the end of the page under "How this classification was reached".

Quick stats

Citations0
Published2013
Admission routes2
Has abstractyes

Explore more

Same venueJournal of undergraduate research in AlbertaSame topicRenal and related cancersFrench-language works237,207