Probing the Ionic Atmosphere and Hydration of the c-MYC <i>i</i>-Motif
Bibliographic record
Abstract
G-quadruplexes and i-motifs are noncanonical secondary structures of DNA that appear to play a number of regulatory roles in the genome with clear connection to disease. Characterization of the forces stabilizing these structures is necessary for developing an ability to induce G-quadruplex and/or i-motif structures at selected genomic loci in a controlled manner. We report here the results of pH-dependent acoustic and densimetric measurements and UV melting experiments at elevated pressures to scrutinize changes in hydration and ionic atmosphere accompanying i-motif formation by the C-rich DNA sequence from the promoter region of the human c-MYC oncogene [5'-d(TTACCCACCCTACCCACCCTCA)] (ODN). We also conducted pH-dependent acoustic and densimetric characterizations of two DNA molecules that are compositionally identical to ODN but do not adopt the i-motif conformation, 5'-d(CTCTCACCACACCACACCTCTC) (ODN1) and 5'-d(CACACTCCTCACCTCTCCACAC) (ODN2). Our results reveal that i-motif formation by ODN is not accompanied by changes in volume and compressibility. The volumetric similarity of the i-motif and coil states of ODN implies a fortuitous compensation between changes in the intrinsic and hydration contributions to volume and compressibility. Analysis of the pH-dependent volumetric profiles of ODN, ODN1, and ODN2, along with the data on volumetric changes accompanying the protonation of isolated cytosine and deoxycytidine, suggests that protonation of the cytosines in the oligonucleotides causes release of the majority if not all of their counterions to the bulk. Thus, in the i-motif conformation, the oligomer no longer acts as a polyelectrolyte insofar as counterions are concerned. We discuss the biological ramifications of our results.
Fetched live from OpenAlex and de-inverted. Abstracts are not stored in this database: the inverted indexes are 8.6 GB of the frame’s 9.3 GB of text, and the host has 13 GB free.
How this classification was reachedexpand
Full frame machine prediction
Teacher imitationNot calibrated prevalence, not ground truth. Human validation pending. The Gemma side is a direct model label for every work in the frame, read from the title-only record. The Codex side is a classifier learned from the 10,348 direct Codex labels and calibrated to design-weighted sample rates; fields without enough sample support carry no Codex call. Candidate is the union of the two sides; consensus is their intersection. These outputs are machine_predicted_unvalidated and are not human labels.
Distilled classifier scores by category (both heads)
| Category | Codex | Gemma |
|---|---|---|
| Metaresearch | 0.000 | 0.000 |
| Meta-epidemiology (narrow) | 0.000 | 0.000 |
| Meta-epidemiology (broad) | 0.000 | 0.000 |
| Bibliometrics | 0.000 | 0.000 |
| Science and technology studies | 0.000 | 0.000 |
| Scholarly communication | 0.000 | 0.000 |
| Open science | 0.000 | 0.000 |
| Research integrity | 0.000 | 0.000 |
| Insufficient payload (model declined to judge) | 0.001 | 0.000 |
Machine scores (provisional)
The two teacher heads of the student model, read on this work. A score orders the frame for review; it never asserts a category, and the validation status ships verbatim with every row.
Baseline scores from an immature model (maturity gate not passed, 7 training rounds). Scores rank; they never assert a category.
score_only:v0-immature-baseline · verbatim from the scoring run: score_only means the number may rank works, and no category label ships from itClassification
machine, unvalidatedMachine predicted; a candidate call from one source (direct Gemma or distilled Codex), not a consensus.
How this classification was reached, model by model and score by score, is at the end of the page under "How this classification was reached".