Efficacy of Ruxolitinib Therapy in a Patient With Severe Enterocolitis Associated With a STAT3 Gain-of-Function Mutation
Bibliographic record
Abstract
Severe enterocolitis raises diagnostic and therapeutic challenges. Empirical treatment by steroids and immunosuppressive drugs is commonly used but, to date, little attempt has been made to specifically target the mechanism underlying inflammation. Possible causes of severe enterocolitis include refractory celiac disease,1Malamut G. et al.Gastroenterology. 2009; 136: 81-90Abstract Full Text Full Text PDF PubMed Scopus (305) Google Scholar autoimmune enteropathy,2Akram S. et al.Clin Gastroenterol Hepatol. 2007; 5: 1282-1290Abstract Full Text Full Text PDF PubMed Scopus (195) Google Scholar and common variable immunodeficiency,3Malamut G. et al.Am J Gastroenterol. 2010; 105: 2262-2275Crossref PubMed Scopus (230) Google Scholar the 2 latter being overlapping entities of possible monogenic inheritance. Besides FOXP3 mutations that cause immune dysregulation polyendocrinopathy X-linked syndrome,4Baud O. et al.N Engl J Med. 2001; 344: 1758-1762Crossref PubMed Scopus (236) Google Scholar additional genetic causes have recently been reported.5Flanagan S.E. Haapaniemi E.M. et al.Nat Genet. 2014; 46: 812-814Crossref PubMed Scopus (391) Google Scholar, 6Milner J.D. et al.Blood. 2015; 125: 591-599Crossref PubMed Scopus (401) Google Scholar, 7Schubert D. Bode C. Kenefeck R. Hou T.Z. et al.Nat Med. 2014; 20: 1410-1416Crossref PubMed Scopus (664) Google Scholar Herein, using whole exome sequencing (WES), we identified a novel STAT3 (signal transducer and activator of transduction 3) gain-of-function (GoF) mutation in an adult patient displaying chronic diarrhea and autoimmune manifestations refractory to several lines of immunosuppressive drugs and biotherapies. Identification of the mutation enabled successful treatment with the JAK1/2 inhibitor ruxolitinib. The study was approved by the Ile-de-France II ethical committee (Paris, France). Histological analysis, flow cytometry analysis of isolated lymphocytes, and molecular analysis of gastrointestinal specimens were performed as described.1Malamut G. et al.Gastroenterology. 2009; 136: 81-90Abstract Full Text Full Text PDF PubMed Scopus (305) Google Scholar Genomic DNA was extracted from peripheral blood mononuclear cells isolated by Ficoll HyPaque Plus (GE Healthcare, Velizy-Villacoublay, France) using the QIAamp DNA Blood Mini Kit (Qiagen, Courtaboeuf, France). WES was performed as previously described.8Charbit-Henrion F. et al.J Crohns Colitis. 2018 May 18; https://doi.org/10.1093/ecco-jcc/jjy068Crossref PubMed Scopus (62) Google Scholar Genomic DNA libraries were generated from DNA (3 μg) sheared with a Covaris S2 Ultrasonicator using SureSelectXT Library PrepKit (Agilent, Garches, France) on the Genomic Platform at the Imagine Institute. Capture by hybridization was performed using Agilent Sure Select All Exon V5 (Agilent, Les Ulis, France). Targeted exons were pulled out with magnetic streptavidin beads, polymerase chain reaction (PCR)-amplified using indexing primers and sequenced on an Illumina HiSeq2500 HT system (Illumina, San Diego, CA). Data analysis was performed with Paris Descartes University/Imagine Institute’s Bioinformatics core facilities. Paired-end sequences were mapped on the human genome reference (US National Center for Biotechnology Information build37/hg19 version) using the Burrows-Wheeler Aligner. Downstream processing was carried out with the Genome Analysis Toolkit, SAMtools, and Picard, according to documented best practices (http://www.broadinstitute.org/gatk/guide/topic?name=best-practices). Variant calls were made with the Genome Analysis Toolkit Unified Genotyper based on the 72nd version of the ENSEMBL database. Genome variations were defined using the in-house software PolyQuery, which filters out irrelevant and common polymorphisms based on frequencies extracted from public databases: US National Center for Biotechnology Information database of SNP (dbSNP), 1000 genomes, Exome Variant Server (EVS, http://evs.gs.washington.edu/EVS/), and Exome Aggregation Consortium (ExAC, http://exac.broadinstitute.org). Consequences of mutations on protein function were predicted using 3 algorithms: Polyphen2 (http://genetics.bwh.harvard.edu/pph2/), SIFT (Sorting Intolerant From Tolerant, J. Craig Venter Institute), and Mutation Taster (www.mutationtaster.org). Mutations were then ranked on the basis of the predicted impact of each variant by combined annotation-dependent depletion (CADD), and compared with the mutation significance cutoff, a gene-level specific cutoff for CADD scores (http://pec630.rockefeller.edu:8080/MSC/).9Itan Y. et al.Nat Methods. 2016; 13: 109-110Crossref PubMed Scopus (209) Google Scholar The mutations were confirmed by Sanger sequencing using specific primers targeting exon 13: forward: TCCGGCTACTTGGTCACCTA-3; reverse: 5-CCCCCATTCCCACATCTCTG-3. Mutations into human wild-type STAT3 sequence (NM_139276; Origene) were introduced using the GENEART Site-Directed Mutagenesis System (Invitrogen, Thermo Fisher Scientific, Waltham, MA) and the following primers: c.1201A>G forward: ATGGAAGAATCCAACGACGGCAGCCTCTC TG; c.1201A>G reverse: CAGAGAGGCTGCCGTCGTTGGATTCTTCCAT; c.1175A>G forward: TGGGCACAAACACAAGAGTGATGAACATGGA; c.1175A>G_reverse: TCCATGTTCATC ACTCTTGTGTTTGTGCCCA according to the manufacturer’s instructions. Each mutation was confirmed by direct sequencing of the STAT3 insert (Eurofins, Luxembourg). STAT3 inserts were, then, subcloned into pLVX-EF1alpha-IRES-mCherry lentiviral expression vector (transfer vector) (Clontech, Saint-Germain-en-Laye, France) via the restriction site Not1 (New England Biolabs, Evry, France) and the correct orientation of the insert was confirmed by sequencing. Lentiviral particles encoding the different mutants were generated by transfecting HEK293T cells with transfer plasmid, packaging expressing plasmid psPAX2 (Addgene, Cambridge, MA), VSV-G envelope expressing plasmid PMD2.G (Addgene) using Lipofectamine 2000 (Invitrogen, Thermo Fisher Scientific). Six hours after transfection, cells were washed and new medium without antibiotics was added for 60 hours. The recombinant virus–containing medium was filtered and used to transduce HEK293T cells, stably expressing STAT3-responsive firefly luciferase reporter (Qiagen, Courtaboeuf, France) in the presence of polybrene (4 μg/mL). M-cherry–positive cells were sorted by FACS. Comparable expression of STAT3 protein following transduction of each lentiviral construct was assessed by western blot using mouse anti-STAT3 antibody (124H6, 1:1000; Cell Signaling, Saint Quentin Yvelines Cedex, France), and rabbit anti-gapdh (14C10, 1:1000; Cell Signaling). STAT3 reporter activity was evaluated on 10 ng/mL interleukin (IL)-6 stimulation for 48 hours using the Dual-luciferase reporter assay system (E1910, Promega, Charbonnières-les-Bains, France) according to the manufacturer’s recommendations. For analysis of SOCS3 transcription, Epstein-Barr virus (EBV) immortalized B-cell lines derived from the patient, from 2 healthy donors, and from 1 patient carrying the previously described GoF p.T716M mutation in STAT3 DNA binding domain, were stimulated for 20 hours with 10 ng/mL IL21 (R&D Systems, Lille France) or with 5 ng/mL IL6 (R&D Systems). Cells (1 × 106) were lysed in RLT plus buffer (Qiagen) and RNA extracted using RNAeasy kit (Qiagen). For cytokine mRNA expression studies, intestinal tissues were immediately placed in RNA later (ThermoFisher Scientific) and stored at –80 oC. RNA was extracted using RNAeasy kit (Qiagen). Quantitative reverse transcriptase PCR was performed on Applied Biosystems 7300 Real-Time PCR apparatus as described using TaqMan universal PCR Master Mix and Taqman probe assays (ThermoFisher Scientific, Montigny-Le-Bretonneaux France): RPLP0 (Hs99999902_m1); SOCS3 (Hs02330328_s1); GzmB (Hs01554355_m1); TNFalpha (Hs99999043_ml); IFNG (Hs99999041_m1); IL6 (Hs00985639_m1); IL10 (Hs00961622_m1); IL12A (Hs009673447_m1); IL17A (Hs00174383_m1); IL21 (Hs00222327_m1); IL22 (Hs01574154_m1); IL23 (Hs00372324_m1). Results were expressed as relative expression 2–ΔCt normalized to the housekeeping ribosomal Protein Large PO (RPLPO) gene. A Caucasian woman followed for diarrhea since the age of 5 months was referred to our adult center in 2011 at the age of 19. Severe intestinal villous atrophy refractory to gluten-free diet was diagnosed at 3 years. At 6 years, she developed neutropenia, thrombopenia with anti-platelet antibodies, and Hashimoto thyroiditis with anti-thyroglobulin antibodies. At 8 years, severe diarrhea relapsed with subtotal duodenal atrophy and colonic apoptotic lesions. No antibodies against gliadin or enterocytes were detected, but serum immunoglobulin (Ig)G was low (4g/L<5.5g/L) with normal IgM, IgA, and IgE. Between 3 and 18 years, she was successively treated by steroids, tacrolimus, and azathioprine, but had frequent Clostridium difficile infections. Growth hormone treatment failed to improve the severe growth retardation (−2.5 SD). In 2011, she had moderate diarrhea on azathioprine with normal duodenal architecture and mild colonic inflammation. CD4, B, and natural killer lymphopenia in peripheral blood was ascribed to prolonged treatment by azathioprine. Frequency of CD25highFoxp3+ cells among peripheral CD4+ T cells was 4% (normal: 4%–20%). Phenotyping of isolated duodenal lymphocytes showed predominance of CD3+CD8+TCRαβ+ cells among intraepithelial lymphocytes and comparable frequency of CD4+ and CD8+ TCRαβ+ cells in the lamina propria. Expression of the activating natural killer receptor NKG2C on 10% and 5% of lymphocytes in epithelium and lamina propria, respectively, suggested moderate activation. Molecular analysis of gastric, duodenal, and colonic biopsies revealed polyclonal TCRγ, IgH, and Ig Kappa repertoires. No anti-AIE75 KD antibodies were detected and serum IgG1 (2.4 g/L< 4g/L) and IgG3 (0,04g/L <0.17g/L) were low. Between 2012 and 2014, the patient had severe viral infections, including primary parvovirus B19, cytomegalovirus infections and EBV reactivation. She received high doses of intravenous immunoglobulins and azathioprine was switched to budesonide. Adalimumab, introduced in 2014 because of increased serum concentrations of tumor necrosis factor (TNF)-α, decreased diarrhea and allowed 8 kg weight gain. However, clinical relapse occurred and was not controlled by golimumab, a distinct TNF-α antibody. Disease severity and very early onset suggested a monogenic disease. Accordingly, WES identified a de novo heterozygous missense variant, c.1201A>G, in exon 13 of STAT3 (Figure 1A, Supplementary Table 1), which was confirmed by Sanger sequencing (Figure 1B and C). Both germline loss-of-function mutations and germline and somatic GoF STAT3 mutations have been described.5Flanagan S.E. Haapaniemi E.M. et al.Nat Genet. 2014; 46: 812-814Crossref PubMed Scopus (391) Google Scholar, 6Milner J.D. et al.Blood. 2015; 125: 591-599Crossref PubMed Scopus (401) Google Scholar, 10Ettersperger J. Montcuquet N. et al.Immunity. 2016; 45: 610-625Abstract Full Text Full Text PDF PubMed Scopus (111) Google Scholar, 11Haapaniemi E.M. et al.Blood. 2015; 125: 639-648Crossref PubMed Scopus (214) Google Scholar, 12Vogel T.P. et al.J Clin Immunol. 2015; 35: 615-623Crossref PubMed Scopus (132) Google Scholar Notably, activating germline STAT3 mutations can cause multiorgan autoimmunity and enteritis.5Flanagan S.E. Haapaniemi E.M. et al.Nat Genet. 2014; 46: 812-814Crossref PubMed Scopus (391) Google Scholar, 6Milner J.D. et al.Blood. 2015; 125: 591-599Crossref PubMed Scopus (401) Google Scholar The c.1201A>G variant was absent in all public databases and in our in-house database (12,925 exomes). This variant replaces the highly conserved asparagine in position 401 to aspartic acid (p.N401D, Figure 1D and E) within the DNA binding domain. This change was predicted to be damaging by all algorithms (Polyphen2 [0.949], Sift [0.02], MutationTaster). CADD score was very high (29.7). As for other previously reported GoF STAT3 mutations within the DNA binding domain,5Flanagan S.E. Haapaniemi E.M. et al.Nat Genet. 2014; 46: 812-814Crossref PubMed Scopus (391) Google Scholar, 6Milner J.D. et al.Blood. 2015; 125: 591-599Crossref PubMed Scopus (401) Google Scholar we predicted that the mutated protein will retain increased AGG-element binding activity following activation and therefore increased transcriptional activity. Expression of the N401D mutant, in HEK293T cells expressing STAT3-responsive element, resulted in increased luciferase reporter activity compared with wild-type STAT3 on IL6 stimulation and comparable to the known STAT3 GoF allele K392R5Flanagan S.E. Haapaniemi E.M. et al.Nat Genet. 2014; 46: 812-814Crossref PubMed Scopus (391) Google Scholar, 6Milner J.D. et al.Blood. 2015; 125: 591-599Crossref PubMed Scopus (401) Google Scholar (Figure 1F). Accordingly, transcription of Suppressor of cytokine signaling 3 (SOCS3), a major target of STAT3, was significantly increased on stimulation by IL21 or by IL6 in the EBV cell line from the patient compared with EBV lines derived from 2 controls and comparable to the EBV line from the know STAT3 GoF T716M carrier patient (Figure 1G). Importantly, IL6- or IL21-induced transcription was significantly reduced on inhibition of JAK1 signaling with ruxolitinib (Figure 1G). Following validation of the STAT3 GoF mutation, and because the patient progressively developed uncontrolled enterocolitis (Figure 2A and B: subtotal duodenal villous atrophy and severe colitis with massive lymphocytic infiltrate and glandular apoptotic bodies), ustekinumab and tocilizumab were tested but without efficacy. In contrast, diarrhea stopped rapidly after introduction of ruxolitinib 10 mg twice a day in April 2017. Ruxolitinib was increased to 15 mg twice a day in July 2017 and budesonide discontinued after 2 months. In November 2017, the patient had gained 5 kg and completed mucosal healing (Figure 2C and D); SOCS3 transcription was markedly reduced in duodenum and colon, indicating efficient blockade of STAT3 signaling; IFN-γ and Granzyme B transcripts were decreased in duodenum and colon and IL-12 and TNF-α transcripts in colon (Figure 2E and F, Supplementary Figure 1). One year later the patient is still in remission. Herein, WES identified a novel STAT3 GoF mutation as the cause of a severe enterocolitis. In keeping with previous reports of STAT3 GoF mutations,5Flanagan S.E. Haapaniemi E.M. et al.Nat Genet. 2014; 46: 812-814Crossref PubMed Scopus (391) Google Scholar, 6Milner J.D. et al.Blood. 2015; 125: 591-599Crossref PubMed Scopus (401) Google Scholar, 11Haapaniemi E.M. et al.Blood. 2015; 125: 639-648Crossref PubMed Scopus (214) Google Scholar the patient displayed other autoimmune symptoms, primary hypogammaglobulinemia and short stature. Following functional validation of the mutation, the patient was successively treated with ustekinumab and tocilizumab to prevent activation of STAT3 downstream IL23 and IL6 receptor, respectively. Both treatments were inefficient despite 1 case report of enterocolitis with STAT3 GoF mutation clinically improved by tocilizumab.13Khoury T. et al.Clin Ther. 2017; 39: 444-449Abstract Full Text Full Text PDF PubMed Scopus (26) Google Scholar In contrast, ruxolitinib induced rapid and complete remission, indicating that blocking STAT3 activation simultaneously downstream different cytokines may be necessary to control intestinal inflammation. This case is reminiscent of the previous success of this inhibitor in patients with GoF mutation in JAK1, which encodes the kinase upstream STAT3.14Del Bel K.L. Ragotte R.J. et al.J Allergy Clin Immunol. 2017; 139: 2016-2020.e5Abstract Full Text Full Text PDF PubMed Scopus (90) Google Scholar Importantly, somatic STAT3 GoF mutations are observed in many lymphoproliferative disorders and 1 patient with germline STAT3 GoF mutation developed large lymphocytic leukemia at 14 years.11Haapaniemi E.M. et al.Blood. 2015; 125: 639-648Crossref PubMed Scopus (214) Google Scholar Ruxolitinib treatment may help to prevent such complication in our patient. We thank Necker Imagine DNA biobank (BB-033–00065) for establishing the EBV cell lines. Contributors: M. Parlato, F. Charbit-Henrion, N. Cerf-Bensussan, and G. Malamut, conceived the study, reviewed data, and wrote the manuscript. G. Malamut performed the retrospective analysis of medical files. F. Charbit-Henrion analysed WES data. M. Parlato, E. Abi Nader, B. Begue, and N. Guegan performed functional analyses. J. Bruneau performed histological studies and E. Macintyre studied T-cell clonality. M. Allez and L. Le Bourhis provided RNA from colonic tissue samples. F. Rieux-Laucat provided the EBV cell line carrying the known STAT3 mutation. C. Picard performed Sanger analysis. S. Khater, O. Goulet, and C. Cellier provided clinical data, and O. Hermine initiated treatment with ruxolitinib. All the authors reviewed the paper. Supplementary Table 1Variants Identified by WESInheritance modeGeneVariantNucleotide changeAminoacid changeAllele originPolyphen scoreSift scoreMutation Tester scoreCADD scoreAutosomal recessiveZNF721rs781885961c.619A>Gp.N207DMother0.840.39T9.1rs781941891c.485A>Gp.E162GFather0.90T23TNFRSF10A-c.239G>Tp.R80LMother0.070.62T0-c.629+5G>CsplicingFather---5.8SPTBN5-c.7327C>Tp.H2443YMother0.730.94T8.5rs377709735c.8377C>Tp.R2793WFather0.950.02T27.5ANKRD11rs368831797c.6194T>Cp.F2065SMother0.70DC27.4rs770511968c.5230C>Gp.H1744DFather0.890.32DC19.7MUC16rs765644259c.14387C>Gp.T4796RMother--1T0rs201767175c.42181C>Ap.P14061TFather0.99-1T19De novoCAPN15/SOLHrs780136051c.2624C>Tp.A875V-0.970.09DC24STAT3-c.1201A>Gp.N401D-0.430DC29.7NOTE. ANKRD11: not expressed in gut nor in immune cells (nasopharynx). CAPN15 or SOLH: homolog to Drosophila small optic lobes (sol) gene: expressed in spleen, brain, lung and kidney, function poorly described. Bold text concerns the gene of interest.DC, Disease Causing; T, Tolerated. Open table in a new tab NOTE. ANKRD11: not expressed in gut nor in immune cells (nasopharynx). CAPN15 or SOLH: homolog to Drosophila small optic lobes (sol) gene: expressed in spleen, brain, lung and kidney, function poorly described. Bold text concerns the gene of interest. DC, Disease Causing; T, Tolerated. Download .jpg (.35 MB) Help with files Supplementary Figure 1 CorrectionGastroenterologyVol. 156Issue 8PreviewParlato M, Charbit-Henrion F, Abi Nader E, et al. Efficacy of ruxolitinib therapy in a patient with severe enterocolitis associated with a STAT3 gain-of-function mutation. Gastroenterology 2019;156:1206–1210. Full-Text PDF Open Access
Fetched live from OpenAlex and de-inverted. Abstracts are not stored in this database: the inverted indexes are 8.6 GB of the frame’s 9.3 GB of text, and the host has 13 GB free.
How this classification was reachedexpand
Full frame distilled prediction
Teacher imitationNot calibrated prevalence, not ground truth. Human validation pending. Learned from the 10,348 direct Codex labels and 10,348 direct Gemma labels. Candidate is the union of thresholded teacher heads; consensus is their intersection. These outputs are machine_predicted_unvalidated and are not human labels or direct frontier model labels.
Codex and Gemma teacher scores by category
| Category | Codex | Gemma |
|---|---|---|
| Metaresearch | 0.000 | 0.000 |
| Meta-epidemiology (narrow) | 0.000 | 0.000 |
| Meta-epidemiology (broad) | 0.000 | 0.000 |
| Bibliometrics | 0.000 | 0.000 |
| Science and technology studies | 0.000 | 0.001 |
| Scholarly communication | 0.000 | 0.000 |
| Open science | 0.000 | 0.000 |
| Research integrity | 0.000 | 0.000 |
| Insufficient payload (model declined to judge) | 0.000 | 0.000 |
Machine scores (provisional)
The two teacher heads of the student model, read on this work. A score orders the frame for review; it never asserts a category, and the validation status ships verbatim with every row.
Baseline scores from an immature model (maturity gate not passed, 7 training rounds). Scores rank; they never assert a category.
score_only:v0-immature-baseline · verbatim from the scoring run: score_only means the number may rank works, and no category label ships from itClassification
machine, unvalidatedMachine predicted; a candidate call from one teacher head, not a consensus.
How this classification was reached, model by model and score by score, is at the end of the page under "How this classification was reached".