First Report of Strawberry Polerovirus 1 in Strawberry in Nepal

Strawberry (Fragaria x ananassa Duch.) was introduced to Nepal from Japan in the 1990s, and thus, is a relatively new crop in the country. After the initial introduction of cultivar 'Nyoho' in Kakani, Nuwakot, different agencies and growers have introduced a number of cultivars in large numbers from Japan, Europe, America and India to expand the cultivation of strawberry in Nepal. Such practice has increased the risk of introducing new pathogens in the country. During a field visit at Kakani in October 2018, virus-like symptoms were observed in 5-10% of the plants in a polyhouse (~200 m2). Three strawberry leaf samples showing vein banding, vein clearing or tip necrosis with leaf puckering were collected. Total RNA was extracted from leaves using the RNeasy Plant Mini Kit (Qiagen, Germany) and subjected to high-throughput sequencing (HTS). After ribosomal RNA depletion using the Ribo-Zero rRNA kit, a cDNA library was prepared using an Illumina TruSeq Stranded Total RNA Kit and sequenced on an Illumina NovaSeq 6000 system (Macrogen Inc. Korea). De novo transcriptome assembly of the 67,748,658 reads with Trinity software (r20140717) yielded 116,854 contigs of 201-17,773 nucleotides (nt). BLASTn and BLASTx analysis of the contigs against the NCBI viral reference database showed that one contig with the nearly full genome sequence (5,968 nt, deposited under GenBank accssion number MZ355624) was identified as strawberry polerovirus 1 (SPV-1). A total of 10,401 reads was mapped to the reference SPV-1 nucleotide genome (GenBank accession number NC_025435) with a 263.2 sequence depth. The contig shared 99% nt sequence identity with SPV-1 isolate AB5301 (GenBank accession number KM233705) from Canada and 97% identity with the Argentine SPV-1 isolate 15CA (GenBank accession number MK142237). To confirm the presence of SPV-1, reverse transcription-PCR (RT-PCR) was performed using previously reported specific primers, SPV-1F (AGAGATCGCCGGATTCCGCAA) and SPV-1R (TGACACGCTCGGTATTCACAAACAG), amplifying 281 nt of the P1-P2 fusion protein gene (Thekke-Veetil and Tzanetakis 2016). Of the three samples, only one showing vein banding symptoms (Figure S1) was positive for SPV-1. Sanger sequencing of the RT-PCR products showed 100% nt identity with the HTS-derived sequence. SPV-1, a member of the genus Polerovirus in the family Solemoviridae, was first reported in strawberry showing decline symptom in Canada (Xiang et al. 2015), and was subsequently detected in the USA (Thekke-Veetil and Tzanetakis 2016) and in Argentina (Luciani et al. 2016; 2018). To our knowledge, this is the first report of SPV-1 infection in strawberry in Nepal and Asia.

Fetched live from OpenAlex and de-inverted. Abstracts are not stored in this database: the inverted indexes are 8.6 GB of the frame’s 9.3 GB of text, and the host has 13 GB free.