MétaCan
Menu
Back to cohort
Record W4400135396 · doi:10.1094/pdis-05-24-1024-pdn

First Report of Nectarine Virus M in Grapefruit (<i>Citrus × paradisi</i> Macfad.) in Association with Citrus Chlorotic Blotch Disease in Texas, U.S.A.

2024· article· en· W4400135396 on OpenAlexaboutno aff
Avijit Roy, Ashrafou Ouro-Djobo, Samuel Grinstead, John Hammond, Mamoudou Sétamou, Olufemi J. Alabi

Bibliographic record

VenuePlant Disease · 2024
Typearticle
Languageen
FieldAgricultural and Biological Sciences
TopicPlant Virus Research Studies
Canadian institutionsnot available
FundersAgricultural Research Service
KeywordsBiologyCitrus paradisiHorticultureRootstockViroidPlant virusGermplasmBotanyRutaceaeVirusVirology

Abstract

fetched live from OpenAlex

During November 2019, four leaf samples (TX1-TX4) with citrus leprosis-like symptoms in 'Rio Red' grapefruit trees were collected from La Feria, Cameron County, Texas, USA and sent to USDA-Animal and Plant Health Inspection Service - Plant Protection Quarantine, Plant Pathogen Confirmatory Laboratory at Laurel, Maryland for pathogen identification and confirmatory testing. Ribo-depleted libraries for all four samples were prepared for high-throughput sequencing (HTS) analysis, using the RNA extracts of individual grapefruit samples. HTS yielded 13.6 to 22.8 million 75 bp paired-end raw reads per sample library but failed to identify any potential virus-like agent at the time. Recent advances in bioinformatic tools (Roy et al., 2024) prompted a revisit of the archived HTS data and several virus contigs were identified. The assembled contigs covered approximately 82% of the nectarine marafivirus M (NeVM) genome (GenBank accession KT273413) with read depths of 4.72 to 9.96 per-nt. In addition, a few Caulimoviridae and Retroviridae contigs were also identified in the libraries. NeVM was previously discovered from budwoods of nectarine trees from California using HTS and shown to infect peach (Villamor et al., 2016), but no other biological or serological data were reported. Foliar chlorotic blotch symptoms, reminiscent of the 2019 findings, were observed in adjacent Rio Red grapefruit blocks during September 2023. To know the association of chlorotic blotch symptoms with NeVM, 12 symptomatic and 4 non-symptomatic grapefruit samples were collected for testing (Supplementary Figure 1). A conventional RT-PCR primer pair, Marafi Gen-1F (5´AACATGAAGAACGGSTTCGACG 3´)/NeVM-1R (5´TTCATGGTGTGCATGGCRTTYTG 3´), was designed using HTS-derived NeVM contigs and utilized for the development of a detection assay. The results of the 671 bp amplicon sequencing showed that 13 (12+1) of the 16 grapefruit plants (81.25%) were positive for NeVM and shared 87.63-92.25% nt identities with the nectarine isolates of NeVM (KT273411-13) and 78% with the Canadian prunus isolate 13TF170 (MZ291915). To confirm the first report of NeVM in grapefruit trees, the archived 2019 (TX4) and 2023 leaf tissue samples (LF1 and LF2) from La Feria, TX were selected for genetic analysis. The primer pair Marafi Gen-1F/NeVM-1R targeting the helicase domain of NeVM, successfully amplified the expected 671 bp product. The amplicon sequence of isolate TX4 shared 97.76% and 89.87% nt identities with isolates LF1 and LF2, respectively, while LF1 shared 90.76% nt identity with LF2. Sequence variation was observed for a 1906 bp overlapping amplicon obtained with the primer pairs NeVM-2F (5´CTGTTCGCCGAATGCATCAAYCT 3´)/Marafi Gen-1R (5´AGTAGTACCCGCAGAAGGTGG3´) and Marafi Gen-2F (5´CCACCTTCTGCGGGTACTACT3´)/Marafi Gen-2R (5´CTGGAGGTGTTTTCCTTCACCTG3´), spanning the catalytic domain and tymovirus coat protein region of NeVM. The analysis showed that the 1906 bp amplicon sequence of TX4 shared 94 and 95% nt identities with LF2 and LF1, respectively, but only 91% nt identity between them. Overall, the 1906 bp amplicon of all 3 Texas grapefruit isolates shared 91.08 to 92.29% nt identity with American prunus isolates (KT273411-13) and 75% nt identity with Canadian isolate (MZ291915). Three sequences of 671 bp and 1906 bp amplicons were deposited in GenBank under accession numbers PP767656-61. From the regulatory point of view, NeVM fails to satisfy the criteria to be considered as potential quarantine pests for the European Union because of the absence of information on its biology, distribution, and economic impact (Bragard et al., 2019). However, this report expands the natural host range of NeVM to include grapefruit. From an epidemiological standpoint, more data on host range, varietal susceptibility, and genetic variability among citrus and prunus isolates are needed to conclude the association of NeVM infection with symptoms development.

Fetched live from OpenAlex and de-inverted. Abstracts are not stored in this database: the inverted indexes are 8.6 GB of the frame’s 9.3 GB of text, and the host has 13 GB free.

How this classification was reachedexpand

Full frame machine prediction

Teacher imitation

Not calibrated prevalence, not ground truth. Human validation pending. The Gemma side is a direct model label for every work in the frame, read from the title-only record. The Codex side is a classifier learned from the 10,348 direct Codex labels and calibrated to design-weighted sample rates; fields without enough sample support carry no Codex call. Candidate is the union of the two sides; consensus is their intersection. These outputs are machine_predicted_unvalidated and are not human labels.

metaresearch head score (Codex)0.000
metaresearch head score (Gemma)0.000
Version: metacan-v3-hybrid-931329e0061cValidation status: machine_predicted_unvalidated
Candidate categoriesnone
Consensus categoriesnone
DomainCandidate signal: none · Consensus signal: none
Study designCandidate signal: Case report · Consensus signal: none
GenreCandidate signal: Empirical · Consensus signal: Empirical
Teacher disagreement score0.013
Threshold uncertainty score0.025

Distilled classifier scores by category (both heads)

CategoryCodexGemma
Metaresearch0.0000.000
Meta-epidemiology (narrow)0.0000.000
Meta-epidemiology (broad)0.0000.000
Bibliometrics0.0000.000
Science and technology studies0.0010.000
Scholarly communication0.0010.000
Open science0.0000.000
Research integrity0.0010.000
Insufficient payload (model declined to judge)0.0010.000

Machine scores (provisional)

The two teacher heads of the student model, read on this work. A score orders the frame for review; it never asserts a category, and the validation status ships verbatim with every row.

Baseline scores from an immature model (maturity gate not passed, 7 training rounds). Scores rank; they never assert a category.

Opus teacher head0.016
GPT teacher head0.230
Teacher spread0.213 · how far apart the two teachers sit on this one work
Validation statusscore_only:v0-immature-baseline · verbatim from the scoring run: score_only means the number may rank works, and no category label ships from it

Classification

machine, unvalidated

Machine predicted; a candidate call from one source (direct Gemma or distilled Codex), not a consensus.

The models applied no category: nothing in the taxonomy fit this work.
Study designCase report
Domainnot available
GenreEmpirical

How this classification was reached, model by model and score by score, is at the end of the page under "How this classification was reached".

Quick stats

Citations1
Published2024
Admission routes1
Has abstractyes

Explore more

Same venuePlant DiseaseSame topicPlant Virus Research StudiesFrench-language works237,207