Occurrence of Snake River Alfalfa Virus in Alfalfa (<i>Medicago sativa</i>) in Oregon and in Northern California

Alfalfa (Medicago sativa L.) is a commonly grown forage crop in Oregon and California harvested on 350,000 and 480,000 acres, respectively, in 2023 (USDA-NASS 2023). Forage alfalfa is grown as a perennial crop for about four years in the same field and each season, the crop is cut 3-4 times for hay production. Consequently, each plant is exposed to a variety of biotic stresses including virus infections, with pathogens accumulating in the crop over years. Alfalfa was recognized in the past as a reservoir of legume viruses posing threats to peas and other legumes in the Pacific Northwest (PNW) of the United States (Hampton and Weber 1983; Kaiser et al. 1993). The most common viruses found in alfalfa in PNW are aphid-transmitted alfalfa mosaic virus (AMV), bean leafroll virus (BLRV), and pea streak virus (PeSV) (Hampton and Weber 1983; Kaiser et al. 1993; Larsen 2015; Dahan et al. 2022; Postnikova et al. 2023). Recently, a new virus, Snake River alfalfa virus (SRAV) was described from alfalfa in Idaho (Dahan et al. 2022), in Washington (Postnikova et al. 2023), and in Europe (Meseguer et al. 2024). Within PNW, surveys of alfalfa viruses in Oregon were not conducted for the past 30 years, and to fill in this knowledge gap on alfalfa viruses in the State of Oregon, a survey was initiated in the summer 2023. One-hundred thirty-nine leaf samples were collected from 13 alfalfa fields across Oregon, from four fields in Southern Idaho, and from four fields in Northern California between July 15 to September 5, 2023. Five to seven individual samples per field, exhibiting various virus-like symptoms, such as mosaic, chlorotic spots, leaf deformations, and yellowing, were collected randomly, placed in paper bags and shipped to the laboratory at the University of Idaho. Total nucleic acids were extracted from leaf tissue within 3-5 days after the field collections using the Dellaporta methodology (Dellaporta et al. 1983). Reverse transcription (RT) PCR was conducted according to the previously described protocol with specific primers for AMV, BLRV, and SRAV described by Dahan et al. (2022). For PeSV detection, two specific primers, PeSV_2F: TCACTGGATCATGGCYTTTG and PeSV_2R: AACCTTGAATCCTGACGCAA were designed and used in RT-PCR. In virus-positive samples, PCR fragments were treated with Exosap-It (Thermo Fisher Scientific, Waltham, MA), submitted for Sanger sequencing to Elim Biopharmaceuticals, Inc. (Hayward, CA), and confirmed to be virus-specific. The partial sequences of the alfalfa viruses found in Oregon, Idaho, and California were deposited in GenBank under the accession numbers PQ451070 to PQ451075 (PeSV), PQ451076 to PQ451087 (BLRV), PQ451088 to PQ451108 (AMV), and PQ467775 to PQ467806 (SRAV). Out of 139 samples tested, 61 were AMV-positive, 51 were BLRV-positive, 81 were SRAV-positive, and 6 were PeSV-positive. In-field prevalence varied between the four viruses, ranging for PeSV from 0% (1 field in CA, 4 fields in ID, and 8 fields in OR) to 43% (1 field in CA); for BLRV from 0% (2 fields in CA, 2 fields in ID, and 3 fields in OR) to 100% (2 fields in CA); for AMV from 0% (2 fields in CA and 4 fields in ID) to 100% (1 field in OR); for SRAV from 0% (2 fields in CA) to 100% (1 field in OR). Multiple samples had mixed infections of 2, 3, and even 4 viruses (1 sample from CA and 1 sample from OR). The role of each of these viruses in observed alfalfa virus-like symptoms and in an overall effect on productivity awaits further investigation. While SRAV was found before in alfalfa fields in Idaho (Dahan et al. 2022) and Washington (Postnikova et al. 2023), this is the first report of the virus presence in alfalfa crops in Oregon and in Northern California.

Fetched live from OpenAlex and de-inverted. Abstracts are not stored in this database: the inverted indexes are 8.6 GB of the frame’s 9.3 GB of text, and the host has 13 GB free.