MétaCan
Menu
Back to cohort
Record W6893430549 · doi:10.5281/zenodo.16570729

Burnsius communis subsp. tenebrunis Zhang & Cong & Shen & Song & Grishin 2025, new subspecies

2025· article· en· W6893430549 on OpenAlexaboutno aff

Bibliographic record

VenueZenodo (CERN European Organization for Nuclear Research) · 2025
Typearticle
Languageen
FieldComputer Science
TopicBig Data and Digital Economy
Canadian institutionsnot available
Fundersnot available
KeywordsSubspeciesGenBankCladeGenomeWhite (mutation)Type locality

Abstract

fetched live from OpenAlex

Burnsius communis tenebrunis Grishin, new subspecies http://zoobank.org/ E738CD38-E871-4B6A-A77E-4C6C5ED5969E (Figs. 14 part, 15a–d, 16a–b) Definition and diagnosis. Genomic analysis reveals that populations from the Pacific Northwest, currently identified as Burnsius communis communis (Grote, 1872) (type locality in USA: central Alabama), belong to a distinct and strongly supported (99%–100% ultra-fast bootstrap values) clade in the nuclear genome trees, genetically differentiated from others at the subspecies level (Fig. 14 green). Therefore, they represent a new subspecies that keys to “ Pyrgus communis communis ” (G.1.10(a)) in Evans (1953), but differs from it and other relatives by the following combination of characters: a costal fold in males; the harpe dorsally with two prongs (Fig. 16a), but the valva is typically narrower and with a less pronounced costal hump than in specimens from the rest of the range—see Burns (2000) for illustrations—and in these characters is intermediate towards Burnsius albezens Grishin, 2022 (type locality in USA: AZ, Cochise Co.); the wings are usually darker above (especially in females, Fig. 15b) with smaller white spots and areas, and with better-defined dark framing of ventral spots, bands, and veins; and a less olive, duller tone of the ventral bands. Due to significant and uncharacterized in many parts of the range individual variation, this subspecies is best identified by DNA, with diagnostic base pairs in the nuclear genome: aly18826.4.1:C138T, aly383.20.2:C864T, aly383.20.2:G1528T, aly383.20.2:C993T, aly1313.19.2:C189T, aly451.12.5:T86T (not G), aly276378.20.2:A24A (not G), aly276378.20.2:C57C (not T), aly276378.20.2:T60T (not C), aly 1656.6.2:C1106C (not G); but no COI barcode differences. Barcode sequence of the holotype. Sample NVG-24064E07, GenBank PV892288, 658 base pairs: AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGTACTTCTTTAAGTTTATTAATTCGAACTGAATTAGGAAATCCCGGCTCATTAATTGGAGATGATCAAATTTATAATACT ATTGTTACAGCACATGCTTTCATTATAATTTTTTTTATAGTCATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTACCTTTAATACTAGGAGCTCCAGATATAGCATTCCCCCGTA TAAATAACATAAGATTTTGATTATTACCCCCTTCATTAACATTACTTATTTCAAGAAGTATTGTAGAAAACGGTGCAGGAACTGGATGAACAGTTTACCCCCCATTATCAGCTAATATTGC TCATCAAGGTTCTTCTGTTGATTTAGCTATTTTTTCATTACATTTAGCAGGAATTTCATCAATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGTATTAGAAATTTATCA TTTGATCAAATACCTTTATTTGTTTGAGCAGTAGGTATTACAGCTTTATTATTATTATTATCATTACCTGTTTTAGCAGGAGCTATTACTATATTATTAACAGATCGAAATTTAAATACAT CATTTTTTGATCCTGCTGGAGGAGGAGATCCTATTTTATATCAACATTTATTT Type material. Holotype: ♂ deposited in the McGuire Center for Lepidoptera and Biodiversity Collection, Gainesville, FL, USA (MGCL), illustrated in Fig. 15a (genitalia Fig. 16a, b), bears the following four printed rectangular labels (handwritten text shown in italics), three white: [W. of Little Deschutes Riv. | near Crescent El. 4400' | Klamath Co, Oregon | August 21, 2004 | COLLECTORS JUNE | & FLOYD PRESTON], [MGCL Accession | 2010-33 | J. & F. Preston], [DNA sample ID: | NVG-24064E07 | c/o Nick V. Grishin], [genitalia: | NVG241111-10 | c/o Nick V. Grishin] and one red [HOLOTYPE ♂ | Burnsius communis | tenebrunis Grishin]. Paratypes: 3♂♂ and 3♀♀: USA, J. & F. Preston leg. [MGCL]: Oregon: 1♂ NVG-23058A02 Jackson Co., 3.2 mi S of OR-66 on Soda Mt. Rd., 5000’, 31-May-1996; Klamath Co., Deschutes National Forest, Little Deschutes River nr. Mowich, 4700 ’: 1♀ NVG-23058A06 29-Jun-2002 (Fig. 15b), 1♀ NVG-24064G09 27- Jun-2007, and 1♂ NVG-24064E08 29 -Jun-2008; and 1♂ NVG-23058A05 Lake Co., Warner Mts., Fremont National Forest, FR3915 4.4 rd. mi S of Camas Creek, 6000’, 7-Jul-2008; and California: 1♀ NVG-23058A03 Del Norte Co., 2 rd. mi E of Rowdy Creek Rd. on Low Divide Rd., 1600’, 1-Sep-2001. Other specimens: Due to genetic similarity (Fig. 14), we currently attribute the following three sequenced specimens to this subspecies but exclude them from the type series, as they exhibit stronger phenotypic differences—being paler and larger—compared to the population at the type locality: British Columbia [CNC]: 1♂ NVG-24012E09, CNCLEP_00163304 Kaslo, 19-Jun-1900, J. W. Cockle (Fig. 15d) and 1♂ NVG-24012E08, CNCLEP_00163301 Fernie, 12-Jun-1934, H. B. Leech (Fig. 15c) and 1♀ NVG-23058A07 USA, Oregon, Wallowa Co., 12 road mi NE of Joseph, on road to Imnaha, 3700’, 26-Jul-2007, J. & F. Preston leg. [MGCL]. Type locality. USA: Oregon, Klamath Co., Deschutes National Forest, west of Little Deschutes River, nr. Crescent, 4400’. Etymology. In Latin, tenebrosus means dark, gloomy, or shadowy, and brunneus means brown. The name is formed as a fusion: tene [brosus] + brun [neus] + [commun] is, given for the darker and browner (not greener) aspect of this subspecies, and is treated as an adjective. Distribution. From British Columbia (Canada), through Oregon to northwestern California (USA).

Fetched live from OpenAlex and de-inverted. Abstracts are not stored in this database: the inverted indexes are 8.6 GB of the frame’s 9.3 GB of text, and the host has 13 GB free.

How this classification was reachedexpand

Full frame machine prediction

Teacher imitation

Not calibrated prevalence, not ground truth. Human validation pending. The Gemma side is a direct model label for every work in the frame, read from the title-only record. The Codex side is a classifier learned from the 10,348 direct Codex labels and calibrated to design-weighted sample rates; fields without enough sample support carry no Codex call. Candidate is the union of the two sides; consensus is their intersection. These outputs are machine_predicted_unvalidated and are not human labels.

metaresearch head score (Codex)0.000
metaresearch head score (Gemma)0.000
Version: metacan-v3-hybrid-931329e0061cValidation status: machine_predicted_unvalidated
Candidate categoriesnone
Consensus categoriesnone
DomainCandidate signal: none · Consensus signal: none
Study designCandidate signal: Not applicable · Consensus signal: none
GenreCandidate signal: Empirical · Consensus signal: Empirical
Teacher disagreement score0.029
Threshold uncertainty score0.058

Distilled classifier scores by category (both heads)

CategoryCodexGemma
Metaresearch0.0000.000
Meta-epidemiology (narrow)0.0000.000
Meta-epidemiology (broad)0.0000.000
Bibliometrics0.0020.002
Science and technology studies0.0010.000
Scholarly communication0.0000.001
Open science0.0000.001
Research integrity0.0000.000
Insufficient payload (model declined to judge)0.0060.001

Machine scores (provisional)

The two teacher heads of the student model, read on this work. A score orders the frame for review; it never asserts a category, and the validation status ships verbatim with every row.

Baseline scores from an immature model (maturity gate not passed, 7 training rounds). Scores rank; they never assert a category.

Opus teacher head0.051
GPT teacher head0.249
Teacher spread0.199 · how far apart the two teachers sit on this one work
Validation statusscore_only:v0-immature-baseline · verbatim from the scoring run: score_only means the number may rank works, and no category label ships from it

Classification

machine, unvalidated

Machine predicted; a candidate call from one source (direct Gemma or distilled Codex), not a consensus.

The models applied no category: nothing in the taxonomy fit this work.
Study designNot applicable
Domainnot available
GenreEmpirical

How this classification was reached, model by model and score by score, is at the end of the page under "How this classification was reached".

Quick stats

Citations0
Published2025
Admission routes1
Has abstractyes

Explore more

Same venueZenodo (CERN European Organization for Nuclear Research)Same topicBig Data and Digital EconomyFrench-language works237,207