Burnsius communis subsp. tenebrunis Zhang & Cong & Shen & Song & Grishin 2025, new subspecies
Notice bibliographique
Résumé
Burnsius communis tenebrunis Grishin, new subspecies http://zoobank.org/ E738CD38-E871-4B6A-A77E-4C6C5ED5969E (Figs. 14 part, 15a–d, 16a–b) Definition and diagnosis. Genomic analysis reveals that populations from the Pacific Northwest, currently identified as Burnsius communis communis (Grote, 1872) (type locality in USA: central Alabama), belong to a distinct and strongly supported (99%–100% ultra-fast bootstrap values) clade in the nuclear genome trees, genetically differentiated from others at the subspecies level (Fig. 14 green). Therefore, they represent a new subspecies that keys to “ Pyrgus communis communis ” (G.1.10(a)) in Evans (1953), but differs from it and other relatives by the following combination of characters: a costal fold in males; the harpe dorsally with two prongs (Fig. 16a), but the valva is typically narrower and with a less pronounced costal hump than in specimens from the rest of the range—see Burns (2000) for illustrations—and in these characters is intermediate towards Burnsius albezens Grishin, 2022 (type locality in USA: AZ, Cochise Co.); the wings are usually darker above (especially in females, Fig. 15b) with smaller white spots and areas, and with better-defined dark framing of ventral spots, bands, and veins; and a less olive, duller tone of the ventral bands. Due to significant and uncharacterized in many parts of the range individual variation, this subspecies is best identified by DNA, with diagnostic base pairs in the nuclear genome: aly18826.4.1:C138T, aly383.20.2:C864T, aly383.20.2:G1528T, aly383.20.2:C993T, aly1313.19.2:C189T, aly451.12.5:T86T (not G), aly276378.20.2:A24A (not G), aly276378.20.2:C57C (not T), aly276378.20.2:T60T (not C), aly 1656.6.2:C1106C (not G); but no COI barcode differences. Barcode sequence of the holotype. Sample NVG-24064E07, GenBank PV892288, 658 base pairs: AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGTACTTCTTTAAGTTTATTAATTCGAACTGAATTAGGAAATCCCGGCTCATTAATTGGAGATGATCAAATTTATAATACT ATTGTTACAGCACATGCTTTCATTATAATTTTTTTTATAGTCATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTACCTTTAATACTAGGAGCTCCAGATATAGCATTCCCCCGTA TAAATAACATAAGATTTTGATTATTACCCCCTTCATTAACATTACTTATTTCAAGAAGTATTGTAGAAAACGGTGCAGGAACTGGATGAACAGTTTACCCCCCATTATCAGCTAATATTGC TCATCAAGGTTCTTCTGTTGATTTAGCTATTTTTTCATTACATTTAGCAGGAATTTCATCAATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGTATTAGAAATTTATCA TTTGATCAAATACCTTTATTTGTTTGAGCAGTAGGTATTACAGCTTTATTATTATTATTATCATTACCTGTTTTAGCAGGAGCTATTACTATATTATTAACAGATCGAAATTTAAATACAT CATTTTTTGATCCTGCTGGAGGAGGAGATCCTATTTTATATCAACATTTATTT Type material. Holotype: ♂ deposited in the McGuire Center for Lepidoptera and Biodiversity Collection, Gainesville, FL, USA (MGCL), illustrated in Fig. 15a (genitalia Fig. 16a, b), bears the following four printed rectangular labels (handwritten text shown in italics), three white: [W. of Little Deschutes Riv. | near Crescent El. 4400' | Klamath Co, Oregon | August 21, 2004 | COLLECTORS JUNE | & FLOYD PRESTON], [MGCL Accession | 2010-33 | J. & F. Preston], [DNA sample ID: | NVG-24064E07 | c/o Nick V. Grishin], [genitalia: | NVG241111-10 | c/o Nick V. Grishin] and one red [HOLOTYPE ♂ | Burnsius communis | tenebrunis Grishin]. Paratypes: 3♂♂ and 3♀♀: USA, J. & F. Preston leg. [MGCL]: Oregon: 1♂ NVG-23058A02 Jackson Co., 3.2 mi S of OR-66 on Soda Mt. Rd., 5000’, 31-May-1996; Klamath Co., Deschutes National Forest, Little Deschutes River nr. Mowich, 4700 ’: 1♀ NVG-23058A06 29-Jun-2002 (Fig. 15b), 1♀ NVG-24064G09 27- Jun-2007, and 1♂ NVG-24064E08 29 -Jun-2008; and 1♂ NVG-23058A05 Lake Co., Warner Mts., Fremont National Forest, FR3915 4.4 rd. mi S of Camas Creek, 6000’, 7-Jul-2008; and California: 1♀ NVG-23058A03 Del Norte Co., 2 rd. mi E of Rowdy Creek Rd. on Low Divide Rd., 1600’, 1-Sep-2001. Other specimens: Due to genetic similarity (Fig. 14), we currently attribute the following three sequenced specimens to this subspecies but exclude them from the type series, as they exhibit stronger phenotypic differences—being paler and larger—compared to the population at the type locality: British Columbia [CNC]: 1♂ NVG-24012E09, CNCLEP_00163304 Kaslo, 19-Jun-1900, J. W. Cockle (Fig. 15d) and 1♂ NVG-24012E08, CNCLEP_00163301 Fernie, 12-Jun-1934, H. B. Leech (Fig. 15c) and 1♀ NVG-23058A07 USA, Oregon, Wallowa Co., 12 road mi NE of Joseph, on road to Imnaha, 3700’, 26-Jul-2007, J. & F. Preston leg. [MGCL]. Type locality. USA: Oregon, Klamath Co., Deschutes National Forest, west of Little Deschutes River, nr. Crescent, 4400’. Etymology. In Latin, tenebrosus means dark, gloomy, or shadowy, and brunneus means brown. The name is formed as a fusion: tene [brosus] + brun [neus] + [commun] is, given for the darker and browner (not greener) aspect of this subspecies, and is treated as an adjective. Distribution. From British Columbia (Canada), through Oregon to northwestern California (USA).
Récupéré en direct depuis OpenAlex et désinversé. Les résumés ne sont pas conservés dans cette base de données : les index inversés représentent 8,6 Go des 9,3 Go de texte de la base, et le serveur dispose de 13 Go libres.
Comment cette classification a été obtenuedéplier
Prédiction machine sur la base complète
Imitation des enseignantsNi prévalence calibrée, ni vérité terrain. Validation humaine à venir. Le volet Gemma est une étiquette directe du modèle pour chaque travail de la base, lue sur la notice réduite au titre. Le volet Codex est un classifieur appris des 10 348 étiquettes directes de Codex et calibré sur les taux pondérés de l'échantillon; les champs sans appui suffisant ne portent aucun appel Codex. Le mode candidate est l'union des deux volets; le consensus est leur intersection. Ces sorties portent le statut machine_predicted_unvalidated et ne sont pas des étiquettes humaines.
Scores du classifieur distillé par catégorie (deux têtes)
| Catégorie | Codex | Gemma |
|---|---|---|
| Métarecherche | 0,000 | 0,000 |
| Méta-épidémiologie (sens strict) | 0,000 | 0,000 |
| Méta-épidémiologie (sens large) | 0,000 | 0,000 |
| Bibliométrie | 0,002 | 0,002 |
| Études des sciences et des technologies | 0,001 | 0,000 |
| Communication savante | 0,000 | 0,001 |
| Science ouverte | 0,000 | 0,001 |
| Intégrité de la recherche | 0,000 | 0,000 |
| Charge utile insuffisante (le modèle a refusé de juger) | 0,006 | 0,001 |
Scores machine (provisoires)
Les deux têtes enseignantes du modèle étudiant, lues sur ce travail. Un score ordonne la base pour la relecture; il n'affirme jamais une catégorie, et le statut de validation accompagne chaque rangée tel quel.
Scores de référence d'un modèle non mature (critères de maturité non atteints, 7 itérations). Un score ordonne; il n'affirme jamais une catégorie.
score_only:v0-immature-baseline · tel quel depuis la passe de notation : score_only signifie que le nombre peut ordonner les travaux, et qu'aucune étiquette de catégorie n'en découleClassification
machine, non validéePrédiction automatique; un appel candidat d’une seule source (Gemma direct ou Codex distillé), pas un consensus.
Le détail, modèle par modèle et score par score, se trouve en fin de page sous « Comment cette classification a été obtenue ».