MétaCan
Menu
Back to cohort
Record W6911864288 · doi:10.5281/zenodo.15269495

Megaselia nivizona Brown & Hartop & Wong 2022, New Species

2022· article· de· W6911864288 on OpenAlexaboutno aff

Bibliographic record

VenueZenodo (CERN European Organization for Nuclear Research) · 2022
Typearticle
Languagede
FieldAgricultural and Biological Sciences
TopicForensic Entomology and Diptera Studies
Canadian institutionsnot available
Fundersnot available
KeywordsHolotypeTable (database)White (mutation)Range (aeronautics)Taxonomy (biology)

Abstract

fetched live from OpenAlex

Megaselia nivizona New Species Figs. 7, 22. urn:lsid:zoobank.org:act: A5F3265C-F303-434A-9BCD- CBA1CF6BEDDD Holotype. Male. Canada: Ontario: Warsaw, Ferris Provincial Park, 44.2829°N, 77.7963°W, 131 m, 18.vii.2014, CBG Collections staff [LACM ENT 366287] (BIOUG33920-B09) (CNCI). Holotype Barcode AACACTTTATTTTATTTTTGGAGCATGAGCT GGAATAGTAGGAACCTCTCTTAGAGTTATAATTCGAGCTGAAT TGGGTCACCCAGGAGCCTTAATTGGTGATGATCAAATTTATAA TGTAATTGTAACTGCCCATGCATTTATTATAATTTCTTTTATAG CTATACCAATTATAATAGGAGGATTTGGAAATTGACTAGTACCC TTGATATTAGGAGCTCCTGATATAGCTTTCCCTCGTATAAATAA TATAAGATTTTGAATACTTCCTCCTTCCTTAACTCTATTACTAG CAAGAAGTATAATAGAAAATGGCGCTGGGACAGGTTGAACTG TTTACCCACCTCTATCCTCTAGAATCGCTCATAGAGGGTCTTCT GTTGATCTTGCAATTTTTTCACTTCATCTAGCAGGAATCTCTTC AATTTTAGGAGCAGTAAATTTTATCACTACAATTATTAATATACG GTCATCAGGAATTACTTTTGACCGAATACCTTTATTTGTTTGAT CTATTGGAATTACAGCTTTACTATTACTTTTATCTTTACCTGTTC TTGCAGGAGCAATTACTATACTTTTAACAGATCGAAATTTTAAT ACCTCATTTTTTGACCCAGCTGGAGGGGGAGATCCTATTCTTT ATCAACACCTATTT------ Paratypes. BIOUG33915-A02, -D07, -D12, BIOUG33920-C05, 4 males, same data as holotype. Other Specimens. 58 further specimens from Ontario (Guelph, Warsaw), and Quebec (Montreal Botanical Garden). Diagnosis. This is one of the most northeastern of the North American M. sulphurizona -group species, known from Ontario and Quebec, Canada. It is distinguished by the light-colored halter and the barcode, which differs from that of the most similar species, M. solizona new species by 5.64% minimum p-distance (Fig. 1, Table 1). This species is in BOLD as BOLD: AAN8707. Distribution. Eastern Canada. Etymology. The name is based on Latin for “snow” (nivis), referring to the white color, and “belt”, a play on words as some of this species’ range is in what is called the “snow belt” of the Great Lakes.

Fetched live from OpenAlex and de-inverted. Abstracts are not stored in this database: the inverted indexes are 8.6 GB of the frame’s 9.3 GB of text, and the host has 13 GB free.

How this classification was reachedexpand

Full frame machine prediction

Teacher imitation

Not calibrated prevalence, not ground truth. Human validation pending. The Gemma side is a direct model label for every work in the frame, read from the title-only record. The Codex side is a classifier learned from the 10,348 direct Codex labels and calibrated to design-weighted sample rates; fields without enough sample support carry no Codex call. Candidate is the union of the two sides; consensus is their intersection. These outputs are machine_predicted_unvalidated and are not human labels.

metaresearch head score (Codex)0.000
metaresearch head score (Gemma)0.000
Version: metacan-v3-hybrid-931329e0061cValidation status: machine_predicted_unvalidated
Candidate categoriesnone
Consensus categoriesnone
DomainCandidate signal: none · Consensus signal: none
Study designCandidate signal: Observational · Consensus signal: none
GenreCandidate signal: Empirical · Consensus signal: none
Teacher disagreement score0.010
Threshold uncertainty score0.034

Distilled classifier scores by category (both heads)

CategoryCodexGemma
Metaresearch0.0000.000
Meta-epidemiology (narrow)0.0000.000
Meta-epidemiology (broad)0.0000.000
Bibliometrics0.0010.001
Science and technology studies0.0010.001
Scholarly communication0.0000.001
Open science0.0010.001
Research integrity0.0000.001
Insufficient payload (model declined to judge)0.0100.004

Machine scores (provisional)

The two teacher heads of the student model, read on this work. A score orders the frame for review; it never asserts a category, and the validation status ships verbatim with every row.

Baseline scores from an immature model (maturity gate not passed, 7 training rounds). Scores rank; they never assert a category.

Opus teacher head0.041
GPT teacher head0.224
Teacher spread0.183 · how far apart the two teachers sit on this one work
Validation statusscore_only:v0-immature-baseline · verbatim from the scoring run: score_only means the number may rank works, and no category label ships from it

Classification

machine, unvalidated

Machine predicted; a candidate call from one source (direct Gemma or distilled Codex), not a consensus.

The models applied no category: nothing in the taxonomy fit this work.
Study designObservational
Domainnot available
GenreEmpirical

How this classification was reached, model by model and score by score, is at the end of the page under "How this classification was reached".

Quick stats

Citations0
Published2022
Admission routes1
Has abstractyes

Explore more

Same venueZenodo (CERN European Organization for Nuclear Research)Same topicForensic Entomology and Diptera StudiesFrench-language works237,207