Hoforsa rebekkae Tedersoo 2024, sp. nov.
Bibliographic record
Abstract
Hoforsa rebekkae Tedersoo sp. nov. Diagnosis. Separation from other species of Hoforsa based on the ITS region (ITS 2 positions 108–127 ggratcycccgaggtgtgaaac; one mismatch allowed) and LSU (positions 546–565 ctcctggtgctctcacccgt; no mismatch allowed) as indicated in Fig. 4. Type. Soil eDNA sample: TUE 128830 (holotype); eDNA sequence EUK 1100001 (lectotype); Pinus sylvestris forest near Hofors, Sweden (60.49 ° N, 16.30 ° E). Description. Other sequences: EUK 1104560 (type locality); OU 004104 (San Francisco, Ecuador, root sample); and KP 889387 and KP 889486 (both coniferous forest soil in British Columbia, Canada). Etymology. Hofors (Swedish) refers to type locality; and Rebekka (Scotch) refers to the first name Rebekka Artz who was the first to collect materials from this genus. Notes. Found from three sites across three continents, with ITS sequences differing up to 3.5 % and LSU sequences up to 0.5 %.
Fetched live from OpenAlex and de-inverted. Abstracts are not stored in this database: the inverted indexes are 8.6 GB of the frame’s 9.3 GB of text, and the host has 13 GB free.
How this classification was reachedexpand
Full frame machine prediction
Teacher imitationNot calibrated prevalence, not ground truth. Human validation pending. The Gemma side is a direct model label for every work in the frame, read from the title-only record. The Codex side is a classifier learned from the 10,348 direct Codex labels and calibrated to design-weighted sample rates; fields without enough sample support carry no Codex call. Candidate is the union of the two sides; consensus is their intersection. These outputs are machine_predicted_unvalidated and are not human labels.
Distilled classifier scores by category (both heads)
| Category | Codex | Gemma |
|---|---|---|
| Metaresearch | 0.000 | 0.001 |
| Meta-epidemiology (narrow) | 0.002 | 0.001 |
| Meta-epidemiology (broad) | 0.001 | 0.000 |
| Bibliometrics | 0.002 | 0.002 |
| Science and technology studies | 0.003 | 0.001 |
| Scholarly communication | 0.002 | 0.003 |
| Open science | 0.001 | 0.002 |
| Research integrity | 0.002 | 0.002 |
| Insufficient payload (model declined to judge) | 0.011 | 0.008 |
Machine scores (provisional)
The two teacher heads of the student model, read on this work. A score orders the frame for review; it never asserts a category, and the validation status ships verbatim with every row.
Baseline scores from an immature model (maturity gate not passed, 7 training rounds). Scores rank; they never assert a category.
score_only:v0-immature-baseline · verbatim from the scoring run: score_only means the number may rank works, and no category label ships from itClassification
machine, unvalidatedMachine predicted; a candidate call from one source (direct Gemma or distilled Codex), not a consensus.
How this classification was reached, model by model and score by score, is at the end of the page under "How this classification was reached".