MétaCan
Menu
Back to cohort
Record W6930908413 · doi:10.5281/zenodo.13286479

Hoforsa rebekkae Tedersoo 2024, sp. nov.

2024· article· en· W6930908413 on OpenAlexaboutno aff

Bibliographic record

VenueZenodo (CERN European Organization for Nuclear Research) · 2024
Typearticle
Languageen
FieldImmunology and Microbiology
TopicReproductive tract infections research
Canadian institutionsnot available
Fundersnot available
KeywordsSequence (biology)Pine forestPinus <genus>Vegetation (pathology)Root (linguistics)

Abstract

fetched live from OpenAlex

Hoforsa rebekkae Tedersoo sp. nov. Diagnosis. Separation from other species of Hoforsa based on the ITS region (ITS 2 positions 108–127 ggratcycccgaggtgtgaaac; one mismatch allowed) and LSU (positions 546–565 ctcctggtgctctcacccgt; no mismatch allowed) as indicated in Fig. 4. Type. Soil eDNA sample: TUE 128830 (holotype); eDNA sequence EUK 1100001 (lectotype); Pinus sylvestris forest near Hofors, Sweden (60.49 ° N, 16.30 ° E). Description. Other sequences: EUK 1104560 (type locality); OU 004104 (San Francisco, Ecuador, root sample); and KP 889387 and KP 889486 (both coniferous forest soil in British Columbia, Canada). Etymology. Hofors (Swedish) refers to type locality; and Rebekka (Scotch) refers to the first name Rebekka Artz who was the first to collect materials from this genus. Notes. Found from three sites across three continents, with ITS sequences differing up to 3.5 % and LSU sequences up to 0.5 %.

Fetched live from OpenAlex and de-inverted. Abstracts are not stored in this database: the inverted indexes are 8.6 GB of the frame’s 9.3 GB of text, and the host has 13 GB free.

How this classification was reachedexpand

Full frame machine prediction

Teacher imitation

Not calibrated prevalence, not ground truth. Human validation pending. The Gemma side is a direct model label for every work in the frame, read from the title-only record. The Codex side is a classifier learned from the 10,348 direct Codex labels and calibrated to design-weighted sample rates; fields without enough sample support carry no Codex call. Candidate is the union of the two sides; consensus is their intersection. These outputs are machine_predicted_unvalidated and are not human labels.

metaresearch head score (Codex)0.000
metaresearch head score (Gemma)0.001
Version: metacan-v3-hybrid-931329e0061cValidation status: machine_predicted_unvalidated
Candidate categoriesnone
Consensus categoriesnone
DomainCandidate signal: none · Consensus signal: none
Study designCandidate signal: Not applicable · Consensus signal: none
GenreCandidate signal: Other · Consensus signal: none
Teacher disagreement score0.031
Threshold uncertainty score0.061

Distilled classifier scores by category (both heads)

CategoryCodexGemma
Metaresearch0.0000.001
Meta-epidemiology (narrow)0.0020.001
Meta-epidemiology (broad)0.0010.000
Bibliometrics0.0020.002
Science and technology studies0.0030.001
Scholarly communication0.0020.003
Open science0.0010.002
Research integrity0.0020.002
Insufficient payload (model declined to judge)0.0110.008

Machine scores (provisional)

The two teacher heads of the student model, read on this work. A score orders the frame for review; it never asserts a category, and the validation status ships verbatim with every row.

Baseline scores from an immature model (maturity gate not passed, 7 training rounds). Scores rank; they never assert a category.

Opus teacher head0.033
GPT teacher head0.272
Teacher spread0.238 · how far apart the two teachers sit on this one work
Validation statusscore_only:v0-immature-baseline · verbatim from the scoring run: score_only means the number may rank works, and no category label ships from it

Classification

machine, unvalidated

Machine predicted; a candidate call from one source (direct Gemma or distilled Codex), not a consensus.

The models applied no category: nothing in the taxonomy fit this work.
Study designNot applicable
Domainnot available
GenreOther

How this classification was reached, model by model and score by score, is at the end of the page under "How this classification was reached".

Quick stats

Citations0
Published2024
Admission routes1
Has abstractyes

Explore more

Same venueZenodo (CERN European Organization for Nuclear Research)Same topicReproductive tract infections researchFrench-language works237,207