MétaCan
Menu
← Back to cohort
Record W6958231519 · doi:10.6084/m9.figshare.12457340

Additional file 3 of PTENP1 is a ceRNA for PTEN: it’s CRISPR clear

2020· article· en· W6958231519 on OpenAlexaff

Bibliographic record

VenueFigshare · 2020
Typearticle
Languageen
FieldBiochemistry, Genetics and Molecular Biology
TopicPI3K/AKT/mTOR signaling in cancer
Canadian institutionsUniversity of TorontoUniversity Health Network
Fundersnot available
KeywordsCRISPRElectropherogramgenomic DNAPTENGenomeDNACas9

Abstract

fetched live from OpenAlex

Additional file 3. Supplementary Figure 1. a sgRNA-PTENP1 sequence. b (left) PTENP1 genomic sequence recognized by sgRNA-PTENP1 (bold), and PAM sequence (5'-TGG-3', underlined). (right) Orthologous PTEN genomic sequence. sgRNA-PTENP1 cannot mediate the cleavage of PTEN because of 4 mismatches (red), one of which falls in the PAM sequence. c Electropherogram of PTENP1 genomic sequence, where the consequences of the cut by Cas9/sgRNA-PTENP1 are shown. The electropherogram was obtained by PCR analysis of the genomic DNA extracted from DU145-Cas9/sgRNA-PTENP1 double infected cells, 3 days after Cas9 induction using 2ug/ml doxycycline. The primers used for amplification were: Fw- attcgtcttctccccattcc; Rv-tctgcaggaaatcccatagc.

Fetched live from OpenAlex and de-inverted. Abstracts are not stored in this database: the inverted indexes are 8.6 GB of the frame’s 9.3 GB of text, and the host has 13 GB free.

How this classification was reachedexpand

Full frame machine prediction

Teacher imitation

Not calibrated prevalence, not ground truth. Human validation pending. The Gemma side is a direct model label for every work in the frame, read from the title-only record. The Codex side is a classifier learned from the 10,348 direct Codex labels and calibrated to design-weighted sample rates; fields without enough sample support carry no Codex call. Candidate is the union of the two sides; consensus is their intersection. These outputs are machine_predicted_unvalidated and are not human labels.

metaresearch head score (Codex)0.002
metaresearch head score (Gemma)0.014
Version: metacan-v3-hybrid-931329e0061cValidation status: machine_predicted_unvalidated
Candidate categoriesInsufficient payload (model declined to judge)
Consensus categoriesnone
DomainCandidate signal: none · Consensus signal: none
Study designCandidate signal: Not applicable · Consensus signal: Not applicable
GenreCandidate signal: Dataset · Consensus signal: Dataset
Teacher disagreement score0.882
Threshold uncertainty score0.169

Distilled classifier scores by category (both heads)

CategoryCodexGemma
Metaresearch0.0020.014
Meta-epidemiology (narrow)0.0020.001
Meta-epidemiology (broad)0.0020.001
Bibliometrics0.0020.002
Science and technology studies0.0010.000
Scholarly communication0.0020.002
Open science0.0020.001
Research integrity0.0020.001
Insufficient payload (model declined to judge)0.8820.381

Machine scores (provisional)

The two teacher heads of the student model, read on this work. A score orders the frame for review; it never asserts a category, and the validation status ships verbatim with every row.

Baseline scores from an immature model (maturity gate not passed, 7 training rounds). Scores rank; they never assert a category.

Opus teacher head0.050
GPT teacher head0.273
Teacher spread0.223 · how far apart the two teachers sit on this one work
Validation statusscore_only:v0-immature-baseline · verbatim from the scoring run: score_only means the number may rank works, and no category label ships from it

Classification

machine, unvalidated

Machine predicted; a candidate call from one source (direct Gemma or distilled Codex), not a consensus.

Study designNot applicable
Domainnot available
GenreDataset

How this classification was reached, model by model and score by score, is at the end of the page under "How this classification was reached".

Quick stats

Citations0
Published2020
Admission routes1
Has abstractyes

Explore more

Same venueFigshare→Same topicPI3K/AKT/mTOR signaling in cancer→French-language works237,207→