MétaCan
Menu
← Back to cohort
Record W6958428846 · doi:10.6084/m9.figshare.16821770

Additional file 8 of Comparative analysis of full-length mitochondrial genomes of five Skeletonema species reveals conserved genome organization and recent speciation

2021· article· en· W6958428846 on OpenAlexaff

Bibliographic record

VenueFigshare · 2021
Typearticle
Languageen
FieldBiochemistry, Genetics and Molecular Biology
TopicGenomics and Phylogenetic Studies
Canadian institutionsSimon Fraser University
Fundersnot available
KeywordsIsochrysis galbanaGenomeHeterosigma akashiwoGenetic algorithmEmiliania huxleyiGene

Abstract

fetched live from OpenAlex

Additional file 8. The agarose gels image of PCR products for cox1 and region VI among Skeletonema species and other eleven species (Thalassiosira pseudonana, Chaetoceros muelleri, Heterosigma akashiwo, Aureococcus anophagefferens, Chattonella marina, Amphidinium carterae, Alexandrium tamarense, Karenia mikimotoi, Prorocentrum donghaiense, Isochrysis galbana and Phaeocystis globosa). The primers of cox1 gene were, F: GGAACTTTATATTTAATYTTTGGWGC, R: AATACCAGAATTAGCAAGAACAAC [40]. The full-length gels are presented in Additional file 16.

Fetched live from OpenAlex and de-inverted. Abstracts are not stored in this database: the inverted indexes are 8.6 GB of the frame’s 9.3 GB of text, and the host has 13 GB free.

How this classification was reachedexpand

Full frame machine prediction

Teacher imitation

Not calibrated prevalence, not ground truth. Human validation pending. The Gemma side is a direct model label for every work in the frame, read from the title-only record. The Codex side is a classifier learned from the 10,348 direct Codex labels and calibrated to design-weighted sample rates; fields without enough sample support carry no Codex call. Candidate is the union of the two sides; consensus is their intersection. These outputs are machine_predicted_unvalidated and are not human labels.

metaresearch head score (Codex)0.002
metaresearch head score (Gemma)0.013
Version: metacan-v3-hybrid-931329e0061cValidation status: machine_predicted_unvalidated
Candidate categoriesInsufficient payload (model declined to judge)
Consensus categoriesnone
DomainCandidate signal: none · Consensus signal: none
Study designCandidate signal: Observational · Consensus signal: none
GenreCandidate signal: Dataset · Consensus signal: Dataset
Teacher disagreement score0.813
Threshold uncertainty score0.267

Distilled classifier scores by category (both heads)

CategoryCodexGemma
Metaresearch0.0020.013
Meta-epidemiology (narrow)0.0010.001
Meta-epidemiology (broad)0.0020.001
Bibliometrics0.0030.005
Science and technology studies0.0010.000
Scholarly communication0.0020.002
Open science0.0030.002
Research integrity0.0010.001
Insufficient payload (model declined to judge)0.8130.193

Machine scores (provisional)

The two teacher heads of the student model, read on this work. A score orders the frame for review; it never asserts a category, and the validation status ships verbatim with every row.

Baseline scores from an immature model (maturity gate not passed, 7 training rounds). Scores rank; they never assert a category.

Opus teacher head0.022
GPT teacher head0.233
Teacher spread0.211 · how far apart the two teachers sit on this one work
Validation statusscore_only:v0-immature-baseline · verbatim from the scoring run: score_only means the number may rank works, and no category label ships from it

Classification

machine, unvalidated

Machine predicted; a candidate call from one source (direct Gemma or distilled Codex), not a consensus.

Study designObservational
Domainnot available
GenreDataset

How this classification was reached, model by model and score by score, is at the end of the page under "How this classification was reached".

Quick stats

Citations0
Published2021
Admission routes1
Has abstractyes

Explore more

Same venueFigshare→Same topicGenomics and Phylogenetic Studies→French-language works237,207→