Nematovomyces Tedersoo & Esmaeilzadeh-Salestani 2025, gen. nov.
Bibliographic record
Abstract
Nematovomyces Tedersoo & Esmaeilzadeh-Salestani gen. nov. Type species. Nematovomyces vermicola (G. L. Barron & Szuarto) Tedersoo & Esmaeilzadeh-Salestani. Diagnosis. Separated from the vascular plant-associated species and algae-associated species of Olpidium s. stricto based on reticulate to spiky ornamentation in resting spores instead of star-like shapes. Nematovomyces spp. infect nematodes, rotifers, and their eggs. Distinguishable from other fungi based on diagnostic nucleotide signatures in SSU V 4 (positions 729–743 aaccgggtgtggcct in S. cerevisiae; no mismatch allowed) and ITS 2 (positions 68–77 aacaatgtct in N. soinasteënsis; one mismatch allowed) and LSU D 2 (positions 679–698 in N. soinasteënsis and 595–614 in S. cerevisiae: gttgtctttgttattttcca; one mismatch allowed). Forms a monophyletic, least inclusive clade in Nematovomycetaceae, covering sequences OQ 702947, GQ 330624, OQ 702883, JN 054659, JN 054675, OQ 702805, EUK 1100016, EUK 1107129, EUK 1102228, EUK 1204135, EUK 1124398, EUK 1124395, EUK 1124396, and EUK 1124397 (Figs 1, 55). Description. Sporangia in the host cell singly or in rows, spherical or pyriform, 15–35 µm diam., with a smooth wall and curved exit tube. Zoospores spherical, 2.5–3.5 µm diam, with one posterior flagellum. Flagellum arched near the insertion point to the zoospore body. Thallus produces a single evacuation tube that leaves a narrow exit tube. Resting spores spherical or oblong, with surface ornamented by delicate reticular pattern or linear or branched spines, arranged in chains outside the animal cuticle or in culture. Infects nematodes, rotifers, and their eggs internally. Notes. Includes species parasitizing on nematodes, rotifers, and their eggs. Comprises about 50 potential species represented by sequences OQ 702947 (peatland rotifer in MI, USA), GQ 330624 (peatland water in Switzerland), OQ 702883 (rotifer egg in lake water in ONT, Canada), JN 054659 (activated sludge in NSW, Australia), JN 054675 (activated sludge in Canada), EUK 1100016 (permafrost in Canada), EUK 1107129 (lake water in Sweden), EUK 1102228 (forest soil in Puerto Rico), EUK 1204135 (lake sediment in Lithuania), EUK 1124398 (forest soil in Estonia), EUK 1124395 (grassland soil in Estonia), and EUK 1200775 (forest soil in Italy).
Fetched live from OpenAlex and de-inverted. Abstracts are not stored in this database: the inverted indexes are 8.6 GB of the frame’s 9.3 GB of text, and the host has 13 GB free.
How this classification was reachedexpand
Full frame machine prediction
Teacher imitationNot calibrated prevalence, not ground truth. Human validation pending. The Gemma side is a direct model label for every work in the frame, read from the title-only record. The Codex side is a classifier learned from the 10,348 direct Codex labels and calibrated to design-weighted sample rates; fields without enough sample support carry no Codex call. Candidate is the union of the two sides; consensus is their intersection. These outputs are machine_predicted_unvalidated and are not human labels.
Distilled classifier scores by category (both heads)
| Category | Codex | Gemma |
|---|---|---|
| Metaresearch | 0.000 | 0.000 |
| Meta-epidemiology (narrow) | 0.001 | 0.000 |
| Meta-epidemiology (broad) | 0.000 | 0.000 |
| Bibliometrics | 0.001 | 0.002 |
| Science and technology studies | 0.001 | 0.000 |
| Scholarly communication | 0.001 | 0.001 |
| Open science | 0.000 | 0.001 |
| Research integrity | 0.001 | 0.000 |
| Insufficient payload (model declined to judge) | 0.008 | 0.005 |
Machine scores (provisional)
The two teacher heads of the student model, read on this work. A score orders the frame for review; it never asserts a category, and the validation status ships verbatim with every row.
Baseline scores from an immature model (maturity gate not passed, 7 training rounds). Scores rank; they never assert a category.
score_only:v0-immature-baseline · verbatim from the scoring run: score_only means the number may rank works, and no category label ships from itClassification
machine, unvalidatedMachine predicted; a candidate call from one source (direct Gemma or distilled Codex), not a consensus.
How this classification was reached, model by model and score by score, is at the end of the page under "How this classification was reached".