The presence of both recombinant and nonrecombinant strains of <i>Tomato yellow leaf curl virus</i> on tomato in Réunion Island
Notice bibliographique
Résumé
Tomato yellow leaf curl virus (TYLCV) was first detected in Réunion in 1997, based on symptoms and partial sequence data between the conserved nonanucleotide and the first 5′ quarter of the capsid protein (CP) gene (Peterschmitt et al., 1999). A 516 bp portion of the C4 gene of the same isolate of TYLCV from Réunion was subsequently sequenced (Accession No. AJ842312), showing that it belonged to the mild strain (TYLCV-Mld[RE]) and the so-called nonrecombinant group (Navas-Castillo et al., 2000). In April 2004, severe symptoms of stunting, yellowing and leaf curling, resembling the symptoms of tomato yellow leaf curl disease, were observed on tomato plants in Saint Gilles in the north-west region of Réunion. Twenty-two leaf samples from affected tomato plants were collected and tested for the presence of begomoviruses using a PCR assay with two sets of primers designed to amplify two regions of the A component of TYLCV: primers V2790 and C837 amplify a 800 bp fragment spanning the intergenic conserved region (IR) nonanucleotide sequence and two-thirds of the CP gene, while primers TY1944 (TTGTTTTGCCTGTTCTGCTA) and TY2460 (CATCTCCATGTGCTTATCCA) amplify a 516 bp portion of the C4 gene. The latter region was chosen to differentiate the Israeli strain (syn. TYLCV-IL Accession No. X15656) from the mild strain (TYLCV-Mld; Accession No. X76319). All the leaf samples produced PCR products of the expected size with both sets of primers. For three samples, a 483 bp fragment of the C4 gene was sequenced using the primer set TY1944/TY2460 (Accession Nos AJ842309, AJ842310, AJ842311) and a 685 bp fragment of IR/CP region was sequenced using the primer set V2790 (ATCCGTATAATATTACCGGATGG) and C837 GCAAATCATTCTTCACTGTTGC) (Accession Nos AJ842306, AJ842307, AJ842308). The sequences were aligned with those of known TYLCV strains using dnaman (Lynnon Biosoft, Quebec, Canada). The 685 bp fragment showed 98–99% nucleotide identity with TYLCV, TYLCV-Mld and -Mld[RE]. However, the 483 bp fragment showed a 98% nucleotide identity with TYLCV, but only 77% nucleotide identity with TYLCV-Mld and the previous Réunion isolate TYLCV-Mld[RE]. This is the first report of the presence of the Israeli strain, which belongs to the so-called recombinant group of TYLCV, from Réunion island. This study was funded by the Conseil Régional de La Réunion. The technical assistance of M. Grondin is acknowledged.
Récupéré en direct depuis OpenAlex et désinversé. Les résumés ne sont pas conservés dans cette base de données : les index inversés représentent 8,6 Go des 9,3 Go de texte de la base, et le serveur dispose de 13 Go libres.
Comment cette classification a été obtenuedéplier
Prédiction machine sur la base complète
Imitation des enseignantsNi prévalence calibrée, ni vérité terrain. Validation humaine à venir. Le volet Gemma est une étiquette directe du modèle pour chaque travail de la base, lue sur la notice réduite au titre. Le volet Codex est un classifieur appris des 10 348 étiquettes directes de Codex et calibré sur les taux pondérés de l'échantillon; les champs sans appui suffisant ne portent aucun appel Codex. Le mode candidate est l'union des deux volets; le consensus est leur intersection. Ces sorties portent le statut machine_predicted_unvalidated et ne sont pas des étiquettes humaines.
Scores du classifieur distillé par catégorie (deux têtes)
| Catégorie | Codex | Gemma |
|---|---|---|
| Métarecherche | 0,000 | 0,000 |
| Méta-épidémiologie (sens strict) | 0,001 | 0,000 |
| Méta-épidémiologie (sens large) | 0,000 | 0,000 |
| Bibliométrie | 0,001 | 0,000 |
| Études des sciences et des technologies | 0,000 | 0,000 |
| Communication savante | 0,000 | 0,000 |
| Science ouverte | 0,001 | 0,000 |
| Intégrité de la recherche | 0,001 | 0,001 |
| Charge utile insuffisante (le modèle a refusé de juger) | 0,001 | 0,000 |
Scores machine (provisoires)
Les deux têtes enseignantes du modèle étudiant, lues sur ce travail. Un score ordonne la base pour la relecture; il n'affirme jamais une catégorie, et le statut de validation accompagne chaque rangée tel quel.
Scores de référence d'un modèle non mature (critères de maturité non atteints, 7 itérations). Un score ordonne; il n'affirme jamais une catégorie.
score_only:v0-immature-baseline · tel quel depuis la passe de notation : score_only signifie que le nombre peut ordonner les travaux, et qu'aucune étiquette de catégorie n'en découleClassification
machine, non validéePrédiction automatique; un appel candidat d’une seule source (Gemma direct ou Codex distillé), pas un consensus.
Le détail, modèle par modèle et score par score, se trouve en fin de page sous « Comment cette classification a été obtenue ».