MétaCan
Menu
Back to cohort

The presence of both recombinant and nonrecombinant strains of <i>Tomato yellow leaf curl virus</i> on tomato in Réunion Island

2005· article· en· W2030853507 on OpenAlexaboutno aff
Hélène Delatte, Hélène Holota, Florence Nazé, Michel Peterschmitt, Bernard Reynaud, Jean‐Michel Lett

Bibliographic record

VenuePlant Pathology · 2005
Typearticle
Languageen
FieldAgricultural and Biological Sciences
TopicPlant Virus Research Studies
Canadian institutionsnot available
Fundersnot available
KeywordsTomato yellow leaf curl virusBiologyLeaf curlBegomovirusHousekeeping geneVirologyGeneIntergenic regionAccession number (library science)Plant virusBotanyGeneticsGenBankVirusGenomeGene expression

Abstract

fetched live from OpenAlex

Tomato yellow leaf curl virus (TYLCV) was first detected in Réunion in 1997, based on symptoms and partial sequence data between the conserved nonanucleotide and the first 5′ quarter of the capsid protein (CP) gene (Peterschmitt et al., 1999). A 516 bp portion of the C4 gene of the same isolate of TYLCV from Réunion was subsequently sequenced (Accession No. AJ842312), showing that it belonged to the mild strain (TYLCV-Mld[RE]) and the so-called nonrecombinant group (Navas-Castillo et al., 2000). In April 2004, severe symptoms of stunting, yellowing and leaf curling, resembling the symptoms of tomato yellow leaf curl disease, were observed on tomato plants in Saint Gilles in the north-west region of Réunion. Twenty-two leaf samples from affected tomato plants were collected and tested for the presence of begomoviruses using a PCR assay with two sets of primers designed to amplify two regions of the A component of TYLCV: primers V2790 and C837 amplify a 800 bp fragment spanning the intergenic conserved region (IR) nonanucleotide sequence and two-thirds of the CP gene, while primers TY1944 (TTGTTTTGCCTGTTCTGCTA) and TY2460 (CATCTCCATGTGCTTATCCA) amplify a 516 bp portion of the C4 gene. The latter region was chosen to differentiate the Israeli strain (syn. TYLCV-IL Accession No. X15656) from the mild strain (TYLCV-Mld; Accession No. X76319). All the leaf samples produced PCR products of the expected size with both sets of primers. For three samples, a 483 bp fragment of the C4 gene was sequenced using the primer set TY1944/TY2460 (Accession Nos AJ842309, AJ842310, AJ842311) and a 685 bp fragment of IR/CP region was sequenced using the primer set V2790 (ATCCGTATAATATTACCGGATGG) and C837 GCAAATCATTCTTCACTGTTGC) (Accession Nos AJ842306, AJ842307, AJ842308). The sequences were aligned with those of known TYLCV strains using dnaman (Lynnon Biosoft, Quebec, Canada). The 685 bp fragment showed 98–99% nucleotide identity with TYLCV, TYLCV-Mld and -Mld[RE]. However, the 483 bp fragment showed a 98% nucleotide identity with TYLCV, but only 77% nucleotide identity with TYLCV-Mld and the previous Réunion isolate TYLCV-Mld[RE]. This is the first report of the presence of the Israeli strain, which belongs to the so-called recombinant group of TYLCV, from Réunion island. This study was funded by the Conseil Régional de La Réunion. The technical assistance of M. Grondin is acknowledged.

Fetched live from OpenAlex and de-inverted. Abstracts are not stored in this database: the inverted indexes are 8.6 GB of the frame’s 9.3 GB of text, and the host has 13 GB free.

How this classification was reachedexpand

Full frame distilled prediction

Teacher imitation

Not calibrated prevalence, not ground truth. Human validation pending. Learned from the 10,348 direct Codex labels and 10,348 direct Gemma labels. Candidate is the union of thresholded teacher heads; consensus is their intersection. These outputs are machine_predicted_unvalidated and are not human labels or direct frontier model labels.

metaresearch head score (Codex)0.001
metaresearch head score (Gemma)0.000
Version: codex-gemma-dda1882f352aValidation status: machine_predicted_unvalidated
Candidate categoriesnone
Consensus categoriesnone
DomainCandidate signal: none · Consensus signal: none
Study designCandidate signal: Bench or experimental · Consensus signal: none
GenreCandidate signal: Empirical · Consensus signal: Empirical
Teacher disagreement score0.809
Threshold uncertainty score0.991

Codex and Gemma teacher scores by category

CategoryCodexGemma
Metaresearch0.0010.000
Meta-epidemiology (narrow)0.0000.000
Meta-epidemiology (broad)0.0000.000
Bibliometrics0.0000.000
Science and technology studies0.0000.000
Scholarly communication0.0000.000
Open science0.0000.000
Research integrity0.0000.000
Insufficient payload (model declined to judge)0.0000.000

Machine scores (provisional)

The two teacher heads of the student model, read on this work. A score orders the frame for review; it never asserts a category, and the validation status ships verbatim with every row.

Baseline scores from an immature model (maturity gate not passed, 7 training rounds). Scores rank; they never assert a category.

Opus teacher head0.022
GPT teacher head0.246
Teacher spread0.223 · how far apart the two teachers sit on this one work
Validation statusscore_only:v0-immature-baseline · verbatim from the scoring run: score_only means the number may rank works, and no category label ships from it

Classification

machine, unvalidated

Machine predicted; a candidate call from one teacher head, not a consensus.

The models applied no category: nothing in the taxonomy fit this work.
Study designBench or experimental
Domainnot available
GenreEmpirical

How this classification was reached, model by model and score by score, is at the end of the page under "How this classification was reached".

Quick stats

Citations26
Published2005
Admission routes1
Has abstractyes

Explore more

Same venuePlant PathologySame topicPlant Virus Research StudiesFrench-language works237,207