First report of <i>Groundnut ringspot virus</i> in cucumber fruits in Brazil
Notice bibliographique
Résumé
Cucumber (Cucumis sativus) fruits and pepper plants (Capsicum annuum) cultivated in the same commercial greenhouse in Vitoriana, São Paulo, Brazil, in December 2012 and March 2013, respectively, were found with necrotic concentric rings, typical of tospovirus infection (Fig. 1). In addition, thrips were observed in cucumber, pepper and weeds flowers. To confirm the presence of virus, cucumber fruits and pepper leaves with symptoms were collected and tested by plate-trapped antigen (PTA) enzyme linked immunosorbent assay (ELISA) (Mowat & Dawson, 4) using polyclonal antisera against Groundnut ringspot virus (GRSV), Tomato spotted wilt virus (TSWV), Tomato chlorotic spot virus (TCSV) and Zucchini lethal chlorosis virus (ZLCV). The samples reacted only with the antisera against GRSV. Total RNA was extracted, using Norgen total RNA purification kit (Norgen Biotek Corporation, Canada), according to the manufacturer's instructions and tested by reverse transcription-polymerase chain reaction (RT-PCR). Fragments of expected size (453 bp) were amplified using primers BR 60 (5' CCCGGATCCTGCAGAGCAATTGTGTCA 3') and BR 65 (5' ATCAAGCCTTCTGAAAGTCAT 3') corresponding to the part of the nucleocapsid (N) gene as described by Eiras et al. (3). The RT-PCR amplicons were purified with the Qiagen PCR purification kit (Qiagen, Inc. Valencia, CA, USA), and then directly sequenced in both directions at Macrogen Inc., Seoul, Korea. BLAST analysis of the sequenced fragments from cucumber and pepper, deposited in GenBank (Accession Nos. KJ605652 and KJ782432, respectively), revealed 98% nucleotide sequence identity with an isolate of Groundnut ringspot virus (GRSV; GRU49702). Total genomic DNA was extracted from a single female thrips using the Chelex method (Boonham et al., 1). A portion of the mitochondrial cytochrome oxidase I gene (COI) was amplified via standard PCR reaction using the primers mtD-7.2F and mtD-9.2R (Brunner et al., 2). The 450 pb fragment amplified showed 98% identity with Frankliniella schultzei (KF560548). Cucumber fruits and pepper leaves were used for separate sap inoculations onto different species of plants. GRSV from cucumber did not induce symptoms and was not detected in any of the species tested. Using pepper leaves chlorotic local lesions were observed on Chenopodim quinoa, Cucumis sativus cvs. Caipira (Fig. 2), Salada and Aodai; additionally necrotic local lesions on Citrullus lanatus cv. Crimson Sweet (Fig. 3) and initial concentric rings that evolved into systemic necrosis on Datura stramonium, Nicotiana tabacun cv. TNN, N. rustica, N. occidentals and Capsicum annuum cv. Magali. Gomphrena globosa showed chlorotic local lesions, leaf deformation and mottling. The presence or absence of GRSV in plants was confirmed by PTA-ELISA, RT-PCR and viral sequencing. To our knowledge, this is the first report of natural infection of GRSV in cucumber and causing symptoms on fruits.
Récupéré en direct depuis OpenAlex et désinversé. Les résumés ne sont pas conservés dans cette base de données : les index inversés représentent 8,6 Go des 9,3 Go de texte de la base, et le serveur dispose de 13 Go libres.
Comment cette classification a été obtenuedéplier
Prédiction machine sur la base complète
Imitation des enseignantsNi prévalence calibrée, ni vérité terrain. Validation humaine à venir. Le volet Gemma est une étiquette directe du modèle pour chaque travail de la base, lue sur la notice réduite au titre. Le volet Codex est un classifieur appris des 10 348 étiquettes directes de Codex et calibré sur les taux pondérés de l'échantillon; les champs sans appui suffisant ne portent aucun appel Codex. Le mode candidate est l'union des deux volets; le consensus est leur intersection. Ces sorties portent le statut machine_predicted_unvalidated et ne sont pas des étiquettes humaines.
Scores du classifieur distillé par catégorie (deux têtes)
| Catégorie | Codex | Gemma |
|---|---|---|
| Métarecherche | 0,000 | 0,000 |
| Méta-épidémiologie (sens strict) | 0,000 | 0,000 |
| Méta-épidémiologie (sens large) | 0,000 | 0,000 |
| Bibliométrie | 0,001 | 0,000 |
| Études des sciences et des technologies | 0,001 | 0,000 |
| Communication savante | 0,001 | 0,000 |
| Science ouverte | 0,000 | 0,000 |
| Intégrité de la recherche | 0,000 | 0,000 |
| Charge utile insuffisante (le modèle a refusé de juger) | 0,001 | 0,000 |
Scores machine (provisoires)
Les deux têtes enseignantes du modèle étudiant, lues sur ce travail. Un score ordonne la base pour la relecture; il n'affirme jamais une catégorie, et le statut de validation accompagne chaque rangée tel quel.
Scores de référence d'un modèle non mature (critères de maturité non atteints, 7 itérations). Un score ordonne; il n'affirme jamais une catégorie.
score_only:v0-immature-baseline · tel quel depuis la passe de notation : score_only signifie que le nombre peut ordonner les travaux, et qu'aucune étiquette de catégorie n'en découleClassification
machine, non validéePrédiction automatique; un appel candidat d’une seule source (Gemma direct ou Codex distillé), pas un consensus.
Le détail, modèle par modèle et score par score, se trouve en fin de page sous « Comment cette classification a été obtenue ».