MétaCan
Menu
Back to cohort

First report of <i>Groundnut ringspot virus</i> in cucumber fruits in Brazil

2014· article· en· W2060628600 on OpenAlexaboutno aff
D. M. A. Spadotti, Evelynne Urzêdo Leão, Kelly Cristina Gonçalves Rocha, Marcelo Agenor Pavan, Renate Krause‐Sakate

Bibliographic record

VenueNew Disease Reports · 2014
Typearticle
Languageen
FieldAgricultural and Biological Sciences
TopicPlant Virus Research Studies
Canadian institutionsnot available
Fundersnot available
KeywordsBiologyPepperPlant virusTospovirusHorticulturePotato leafroll virusVirusChlorosisCucumisCucumber mosaic virusGenBankVirologyBotanyGeneGeneticsTomato spotted wilt virus

Abstract

fetched live from OpenAlex

Cucumber (Cucumis sativus) fruits and pepper plants (Capsicum annuum) cultivated in the same commercial greenhouse in Vitoriana, São Paulo, Brazil, in December 2012 and March 2013, respectively, were found with necrotic concentric rings, typical of tospovirus infection (Fig. 1). In addition, thrips were observed in cucumber, pepper and weeds flowers. To confirm the presence of virus, cucumber fruits and pepper leaves with symptoms were collected and tested by plate-trapped antigen (PTA) enzyme linked immunosorbent assay (ELISA) (Mowat & Dawson, 4) using polyclonal antisera against Groundnut ringspot virus (GRSV), Tomato spotted wilt virus (TSWV), Tomato chlorotic spot virus (TCSV) and Zucchini lethal chlorosis virus (ZLCV). The samples reacted only with the antisera against GRSV. Total RNA was extracted, using Norgen total RNA purification kit (Norgen Biotek Corporation, Canada), according to the manufacturer's instructions and tested by reverse transcription-polymerase chain reaction (RT-PCR). Fragments of expected size (453 bp) were amplified using primers BR 60 (5' CCCGGATCCTGCAGAGCAATTGTGTCA 3') and BR 65 (5' ATCAAGCCTTCTGAAAGTCAT 3') corresponding to the part of the nucleocapsid (N) gene as described by Eiras et al. (3). The RT-PCR amplicons were purified with the Qiagen PCR purification kit (Qiagen, Inc. Valencia, CA, USA), and then directly sequenced in both directions at Macrogen Inc., Seoul, Korea. BLAST analysis of the sequenced fragments from cucumber and pepper, deposited in GenBank (Accession Nos. KJ605652 and KJ782432, respectively), revealed 98% nucleotide sequence identity with an isolate of Groundnut ringspot virus (GRSV; GRU49702). Total genomic DNA was extracted from a single female thrips using the Chelex method (Boonham et al., 1). A portion of the mitochondrial cytochrome oxidase I gene (COI) was amplified via standard PCR reaction using the primers mtD-7.2F and mtD-9.2R (Brunner et al., 2). The 450 pb fragment amplified showed 98% identity with Frankliniella schultzei (KF560548). Cucumber fruits and pepper leaves were used for separate sap inoculations onto different species of plants. GRSV from cucumber did not induce symptoms and was not detected in any of the species tested. Using pepper leaves chlorotic local lesions were observed on Chenopodim quinoa, Cucumis sativus cvs. Caipira (Fig. 2), Salada and Aodai; additionally necrotic local lesions on Citrullus lanatus cv. Crimson Sweet (Fig. 3) and initial concentric rings that evolved into systemic necrosis on Datura stramonium, Nicotiana tabacun cv. TNN, N. rustica, N. occidentals and Capsicum annuum cv. Magali. Gomphrena globosa showed chlorotic local lesions, leaf deformation and mottling. The presence or absence of GRSV in plants was confirmed by PTA-ELISA, RT-PCR and viral sequencing. To our knowledge, this is the first report of natural infection of GRSV in cucumber and causing symptoms on fruits.

Fetched live from OpenAlex and de-inverted. Abstracts are not stored in this database: the inverted indexes are 8.6 GB of the frame’s 9.3 GB of text, and the host has 13 GB free.

How this classification was reachedexpand

Full frame machine prediction

Teacher imitation

Not calibrated prevalence, not ground truth. Human validation pending. The Gemma side is a direct model label for every work in the frame, read from the title-only record. The Codex side is a classifier learned from the 10,348 direct Codex labels and calibrated to design-weighted sample rates; fields without enough sample support carry no Codex call. Candidate is the union of the two sides; consensus is their intersection. These outputs are machine_predicted_unvalidated and are not human labels.

metaresearch head score (Codex)0.000
metaresearch head score (Gemma)0.000
Version: metacan-v3-hybrid-931329e0061cValidation status: machine_predicted_unvalidated
Candidate categoriesnone
Consensus categoriesnone
DomainCandidate signal: none · Consensus signal: none
Study designCandidate signal: Case report · Consensus signal: none
GenreCandidate signal: Empirical · Consensus signal: Empirical
Teacher disagreement score0.024
Threshold uncertainty score0.047

Distilled classifier scores by category (both heads)

CategoryCodexGemma
Metaresearch0.0000.000
Meta-epidemiology (narrow)0.0000.000
Meta-epidemiology (broad)0.0000.000
Bibliometrics0.0010.000
Science and technology studies0.0010.000
Scholarly communication0.0010.000
Open science0.0000.000
Research integrity0.0000.000
Insufficient payload (model declined to judge)0.0010.000

Machine scores (provisional)

The two teacher heads of the student model, read on this work. A score orders the frame for review; it never asserts a category, and the validation status ships verbatim with every row.

Baseline scores from an immature model (maturity gate not passed, 7 training rounds). Scores rank; they never assert a category.

Opus teacher head0.020
GPT teacher head0.263
Teacher spread0.243 · how far apart the two teachers sit on this one work
Validation statusscore_only:v0-immature-baseline · verbatim from the scoring run: score_only means the number may rank works, and no category label ships from it

Classification

machine, unvalidated

Machine predicted; a candidate call from one source (direct Gemma or distilled Codex), not a consensus.

The models applied no category: nothing in the taxonomy fit this work.
Study designCase report
Domainnot available
GenreEmpirical

How this classification was reached, model by model and score by score, is at the end of the page under "How this classification was reached".

Quick stats

Citations13
Published2014
Admission routes1
Has abstractyes

Explore more

Same venueNew Disease ReportsSame topicPlant Virus Research StudiesFrench-language works237,207