First report of <i>Groundnut ringspot virus</i> in cucumber fruits in Brazil
Why this work is in the frame
A frame that forgets how it found something cannot be audited. These are the routes that admitted this work.
Bibliographic record
Abstract
Cucumber (Cucumis sativus) fruits and pepper plants (Capsicum annuum) cultivated in the same commercial greenhouse in Vitoriana, São Paulo, Brazil, in December 2012 and March 2013, respectively, were found with necrotic concentric rings, typical of tospovirus infection (Fig. 1). In addition, thrips were observed in cucumber, pepper and weeds flowers. To confirm the presence of virus, cucumber fruits and pepper leaves with symptoms were collected and tested by plate-trapped antigen (PTA) enzyme linked immunosorbent assay (ELISA) (Mowat & Dawson, 4) using polyclonal antisera against Groundnut ringspot virus (GRSV), Tomato spotted wilt virus (TSWV), Tomato chlorotic spot virus (TCSV) and Zucchini lethal chlorosis virus (ZLCV). The samples reacted only with the antisera against GRSV. Total RNA was extracted, using Norgen total RNA purification kit (Norgen Biotek Corporation, Canada), according to the manufacturer's instructions and tested by reverse transcription-polymerase chain reaction (RT-PCR). Fragments of expected size (453 bp) were amplified using primers BR 60 (5' CCCGGATCCTGCAGAGCAATTGTGTCA 3') and BR 65 (5' ATCAAGCCTTCTGAAAGTCAT 3') corresponding to the part of the nucleocapsid (N) gene as described by Eiras et al. (3). The RT-PCR amplicons were purified with the Qiagen PCR purification kit (Qiagen, Inc. Valencia, CA, USA), and then directly sequenced in both directions at Macrogen Inc., Seoul, Korea. BLAST analysis of the sequenced fragments from cucumber and pepper, deposited in GenBank (Accession Nos. KJ605652 and KJ782432, respectively), revealed 98% nucleotide sequence identity with an isolate of Groundnut ringspot virus (GRSV; GRU49702). Total genomic DNA was extracted from a single female thrips using the Chelex method (Boonham et al., 1). A portion of the mitochondrial cytochrome oxidase I gene (COI) was amplified via standard PCR reaction using the primers mtD-7.2F and mtD-9.2R (Brunner et al., 2). The 450 pb fragment amplified showed 98% identity with Frankliniella schultzei (KF560548). Cucumber fruits and pepper leaves were used for separate sap inoculations onto different species of plants. GRSV from cucumber did not induce symptoms and was not detected in any of the species tested. Using pepper leaves chlorotic local lesions were observed on Chenopodim quinoa, Cucumis sativus cvs. Caipira (Fig. 2), Salada and Aodai; additionally necrotic local lesions on Citrullus lanatus cv. Crimson Sweet (Fig. 3) and initial concentric rings that evolved into systemic necrosis on Datura stramonium, Nicotiana tabacun cv. TNN, N. rustica, N. occidentals and Capsicum annuum cv. Magali. Gomphrena globosa showed chlorotic local lesions, leaf deformation and mottling. The presence or absence of GRSV in plants was confirmed by PTA-ELISA, RT-PCR and viral sequencing. To our knowledge, this is the first report of natural infection of GRSV in cucumber and causing symptoms on fruits.
Fetched live from OpenAlex and de-inverted. Abstracts are not stored in this database: the inverted indexes are 8.6 GB of the frame’s 9.3 GB of text, and the host has 13 GB free.
Full frame distilled prediction
Teacher imitationNot calibrated prevalence, not ground truth. Human validation pending. Learned from the 10,348 direct Codex labels and 10,348 direct Gemma labels. Candidate is the union of thresholded teacher heads; consensus is their intersection. These outputs are machine_predicted_unvalidated and are not human labels or direct frontier model labels.
Codex and Gemma teacher scores by category
| Category | Codex | Gemma |
|---|---|---|
| Metaresearch | 0.001 | 0.001 |
| Meta-epidemiology (narrow) | 0.000 | 0.000 |
| Meta-epidemiology (broad) | 0.000 | 0.000 |
| Bibliometrics | 0.000 | 0.000 |
| Science and technology studies | 0.000 | 0.000 |
| Scholarly communication | 0.000 | 0.000 |
| Open science | 0.000 | 0.000 |
| Research integrity | 0.000 | 0.000 |
| Insufficient payload (model declined to judge) | 0.000 | 0.000 |
Machine scores (provisional)
The two teacher heads of the student model, read on this work. A score orders the frame for review; it never asserts a category, and the validation status ships verbatim with every row.
Baseline scores from an immature model (maturity gate not passed, 7 training rounds). Scores rank; they never assert a category.
score_only:v0-immature-baseline · verbatim from the scoring run: score_only means the number may rank works, and no category label ships from it