MétaCan
Menu
Retour à la cohorte
Enregistrement W2070379190 · doi:10.1111/j.1601-5223.2009.02140.x

Isolation and characterization of polymorphic microsatellite loci in plainfin midshipman fish

2009· article· en· W2070379190 sur OpenAlexafffundabout
Ho Young Suk, Bryan D. Neff, John L. Fitzpatrick, Sigal Balshine

Notice bibliographique

RevueHereditas · 2009
Typearticle
Langueen
DomaineEnvironmental Science
ThématiqueFish Ecology and Management Studies
Établissements canadiensWestern University
Organismes subventionnairesNatural Sciences and Engineering Research Council of CanadaOntario Innovation Trust
Mots-clésBiologySpawn (biology)Bass (fish)Intertidal zoneZoologyPaternal careReproductive biologyEcologyFishery

Résumé

récupéré en direct d'OpenAlex

Plainfin midshipman, Porichthys notatus (Batrachoidiformes; Batrachoididae), migrate from deeper waters to the intertidal zone along the Pacific coast from Alaska to the Gulf of California to spawn (Feder et al. 1974; Walker and Rosenblatt 1988; Bass 1990). They are nocturnal and hide themselves in sand or mud of the intertidal zone during the day but swim just above the seabed to feed at night (Arora 1948; Thompson et al. 1988). Mating in this species depends on auditory communication; males during the breeding season broadcast a humming sound, generated by rapid contractions of the sonic muscles attached to the lateral sides of their swim bladders (Bass et al. 1999). The female usually lays more than 100 eggs, which typically are attached to the underside of a rock, while the male fertilizes them (Arora 1948; Thompson et al. 1988). After depositing eggs, the female leaves the nest and the male remains and provides parental care. Care behaviour includes fanning the eggs until they hatch and then guarding the larvae until they become free-swimming in about 45 days (Arora 1948). Male plainfin midshipman are sexually dimorphic with two reproductive morphs known as type I and type II (Brantley and Bass 1994; Bass 1996). Type I males are territorial, acoustically court females and then provide parental care for the eggs and larvae. In contrast, type II males are smaller than type I males and frequently steal fertilizations using sneaking or female mimicry behaviour (Brantley et al. 1993; Brantley and Bass 1994; Bass 1996). Although type II males have sonic muscle with contractile apparatus, the ratio of sonic muscle mass to body mass is six times greater in type I males than in type II males; type II males do not hum but do occasionally produce low-amplitude grunts (Bass 1996; Lewis et al. 2003). Type II males also provide no care for their offspring, but instead leave that to the type I males that they parasitize. The plainfin midshipman fish thus provides an opportunity to assess the determinants and evolutionary consequences of alternative mating tactics. To date, however, the molecular markers essential for such studies have not been available. We now describe the development of eight novel and polymorphic microsatellites for this species. During June 2007, midshipman were sampled from three sites in the intertidal zone along Vancouver Island. Two sites, Ladysmith Inlet and Mill Bay, were on the east side of the island and separated by about 50 km. The third site, Bamfield Inlet, was on the west side of the island and separated from the other two by about 230 km (nautical distance). We first constructed a microsatellite DNA-enriched library following the method of Hamilton et al. (1999). Total genomic DNA was extracted from caudal peduncle tissue and digested with Hae III, Rsa I and Nhe I (New England Biolabs). Fragments 400–900 bp in length were ligated to a specific double-stranded linker (SNX; 5′-3′ forward: CTAAGGCCTTGCTAGCAGAAGC; reverse: GCTTCTGCTAGCAAGGCCTTAGAAAA) using T4 DNA ligase (New England Biolabs). The fragments were recovered by polymerase chain reaction (PCR) using the single-stranded forward and reverse linkers as primers. The PCR product was then hybridized to biotinylated (CT)12, (GT)12, (GATA)7, (GATC)7 and (GACA)7 probes. Bound fragments were recovered using streptavidin-coated magnetic beads (Dynabeads M-280 Streptavidin, New England Biolabs). DNA was amplified at 94°C for 10 min, followed by 35 cycles of 30 s at 94°C, 45 s at 58°C, 1 min at 72°C, and a final extension time of 72°C for 10 min using SNA forward primer. PCR products were ligated into the pGEM-T Easy Vector (Promega), transformed into competent Escherichia coli DH5α cells (Invitrogen), and spread onto LB agar plates. Approximately 300 positive clones were sequenced with T7 and SP6 universal primers at the Genome Quebec Innovation Centre (McGill University, Montreal, Canada). Sequences were used to design primers using Primo Pro 3.4 ( ). The loci were then initially screened with 11 individuals from the Ladysmith Inlet site. PCR amplifications were carried out in 10 μl reactions, containing ∼50 ng template DNA, 3 mM MgCl2, 1 × PCR buffer (Invitrogen Life Technologies), 0.25 mM of each deoxynucleotide (Sigma-Aldrich), 0.25 units Taq DNA polymerase (Invitrogen) and 0.25 μM of each forward and reverse primer. Forward primers were labeled with Beckman Dye D2, D3 and D4 (Sigma-Genosys, Woodland, TX, USA). Reactions were performed on T1 Thermocycler (Whatman-Biometra): 94°C for 10 min, 35 cycles of 30 s at 94°C, 30 s either at 58°C (Pon29) or 61°C (all other loci), 30 s at 72°C and final elongation at 72°C for 10 min. The fragment analyses were conducted on a CEQ 8000 (Beckman Coulter). The utility of the polymorphic loci was then examined using a broader sample of 63 individuals encompassing all three sampling sites. For each site, the observed and expected heterozygosity, Hardy-Weinberg equilibrium, and the linkage disequilibrium were calculated using Genepop version 3.4 (Raymond and Rousset 1995). The test for the presence of null alleles was conducted using MICRO-CHECKER ver. 2.2.3 (Van Oosterhout et al. 2004). Population differentiation among the three sites was examined using Genepop and pairwise FST estimates. Hierarchical genetic structuring was analyzed by assessing the relative contributions of among-population and within-population components using an analysis of molecular variance (AMOVA, Excoffier et al. 1992). The AMOVA was performed using the program Arlequin 2.0 (Schneider et al. 1997). Of the about 300 clones sequenced, sufficient flanking sequence was available to design primers for a total of 62 of the clones. Of these 62 loci, 34 (55%) did not amplify consistently, 18 (29%) were monomorphic, 2 (3%) were linked to other loci in our sample, and 8 (13%) amplified reliably and were polymorphic. Based on the larger sample of 63 individuals from three sites, the number of alleles for each locus ranged from three to 10; the observed and expected heterozygosity ranged from 0.30 to 1.00 and from 0.27 to 0.82, respectively (Table 1). Only one locus, Pon23, in Bamfield Inlet was found to be out of Hardy–Weinberg equilibrium following Bonferroni correction. As no deviation was found in the other two sites for Pon23, it is unlikely that the deviation at the Bamfield site was due to a null allele. No linkage was detected between any pair of the eight loci (χ2-tests p > 0.07). Interestingly, the three sites did not show any significant genetic differentiation (pairwise FST= 0.024–0.029; p > 0.09 for all comparisons), which suggests that the three sites may be derived from a single breeding population. The hierarchical AMOVA revealed that most of the genetic variance was found within populations compared to a smaller proportion among populations (percentage of variance; among populations: 2.6%, within populations: 97%, p < 0.05). The lack of detectable genetic divergence among the populations examined could relate to the frequent genetic exchange between the Georgia Straight and west coast of Vancouver Island. The population structure around Vancouver Island may be influenced by seasonal dispersal patterns. The bifurcation of the Subarctic Current off the west coast of Vancouver Island into the southerly flowing California Current and northerly flowing Alaska Current may allow differentiation of dispersal areas (Thomson et al. 1989), as has been reported in dungeness crab (Beacham et al. 2008). Additional surveys of other species are required to fully detail the genetic structure of populations in this area. Nevertheless, our data suggest little genetic structure in populations of plainfin midshipman fish around Vancouver Island. The eight loci developed here will be useful for broader analysis of population structure and gene flow, as well as for evaluation of reproductive success of males that utilize alterative mating tactics. Indeed, the eight loci have a single-parent and parent-pair exclusion probability of 0.90 and 0.99, respectively, which will allow accurate calculation of parentage in this system (Neff et al. 2000). The loci may also be useful in closely related species within the Batrachoididae. Nikita Eskin, Su Youn Baek, Susan Marsh Rollo, Chris Wood, Carol Bucking and Paul Craig provided assistance in the field or laboratory. Funding was provided by the Natural Sciences and Engineering Research Council of Canada, Canadian Foundation for Innovation, Ontario Innovation Trust, and the Univ. of Western Ontario.

Récupéré en direct depuis OpenAlex et désinversé. Les résumés ne sont pas conservés dans cette base de données : les index inversés représentent 8,6 Go des 9,3 Go de texte de la base, et le serveur dispose de 13 Go libres.

Comment cette classification a été obtenuedéplier

Prédiction machine sur la base complète

Imitation des enseignants

Ni prévalence calibrée, ni vérité terrain. Validation humaine à venir. Le volet Gemma est une étiquette directe du modèle pour chaque travail de la base, lue sur la notice réduite au titre. Le volet Codex est un classifieur appris des 10 348 étiquettes directes de Codex et calibré sur les taux pondérés de l'échantillon; les champs sans appui suffisant ne portent aucun appel Codex. Le mode candidate est l'union des deux volets; le consensus est leur intersection. Ces sorties portent le statut machine_predicted_unvalidated et ne sont pas des étiquettes humaines.

score de la tête « metaresearch » (Codex)0,000
score de la tête « metaresearch » (Gemma)0,000
Version: metacan-v3-hybrid-931329e0061cStatut de validation: machine_predicted_unvalidated
Catégories candidatesaucune
Catégories consensuellesaucune
DomaineSignal candidat: aucune · Signal consensuel: aucune
Devis d'étudeSignal candidat: Observationnel · Signal consensuel: Observationnel
GenreSignal candidat: Empirique · Signal consensuel: Empirique
Score de désaccord entre enseignants0,004
Score d'incertitude au seuil0,009

Scores du classifieur distillé par catégorie (deux têtes)

CatégorieCodexGemma
Métarecherche0,0000,000
Méta-épidémiologie (sens strict)0,0000,000
Méta-épidémiologie (sens large)0,0000,000
Bibliométrie0,0010,001
Études des sciences et des technologies0,0000,000
Communication savante0,0000,000
Science ouverte0,0000,000
Intégrité de la recherche0,0000,000
Charge utile insuffisante (le modèle a refusé de juger)0,0010,000

Scores machine (provisoires)

Les deux têtes enseignantes du modèle étudiant, lues sur ce travail. Un score ordonne la base pour la relecture; il n'affirme jamais une catégorie, et le statut de validation accompagne chaque rangée tel quel.

Scores de référence d'un modèle non mature (critères de maturité non atteints, 7 itérations). Un score ordonne; il n'affirme jamais une catégorie.

Tête enseignante Opus0,007
Tête enseignante GPT0,201
Écart entre enseignants0,193 · la distance entre les deux têtes enseignantes sur ce seul travail
Statut de validationscore_only:v0-immature-baseline · tel quel depuis la passe de notation : score_only signifie que le nombre peut ordonner les travaux, et qu'aucune étiquette de catégorie n'en découle

Classification

machine, non validée

Prédiction automatique; un appel candidat d’une seule source (Gemma direct ou Codex distillé), pas un consensus.

Les modèles n’ont appliqué aucune catégorie : rien dans la taxonomie ne correspondait à ce travail.
Devis d'étudeObservationnel
Domainenon disponible
GenreEmpirique

Le détail, modèle par modèle et score par score, se trouve en fin de page sous « Comment cette classification a été obtenue ».

En bref

Citations8
Publié2009
Routes d'admission3
Résumé présentoui

Explorer davantage

Même revueHereditasMême sujetFish Ecology and Management StudiesTravaux en français237 207