MétaCan
Menu
Back to cohort

Isolation and characterization of polymorphic microsatellite loci in plainfin midshipman fish

2009· article· en· W2070379190 on OpenAlexafffundabout
Ho Young Suk, Bryan D. Neff, John L. Fitzpatrick, Sigal Balshine

Bibliographic record

VenueHereditas · 2009
Typearticle
Languageen
FieldEnvironmental Science
TopicFish Ecology and Management Studies
Canadian institutionsWestern University
FundersNatural Sciences and Engineering Research Council of CanadaOntario Innovation Trust
KeywordsBiologySpawn (biology)Bass (fish)Intertidal zoneZoologyPaternal careReproductive biologyEcologyFishery

Abstract

fetched live from OpenAlex

Plainfin midshipman, Porichthys notatus (Batrachoidiformes; Batrachoididae), migrate from deeper waters to the intertidal zone along the Pacific coast from Alaska to the Gulf of California to spawn (Feder et al. 1974; Walker and Rosenblatt 1988; Bass 1990). They are nocturnal and hide themselves in sand or mud of the intertidal zone during the day but swim just above the seabed to feed at night (Arora 1948; Thompson et al. 1988). Mating in this species depends on auditory communication; males during the breeding season broadcast a humming sound, generated by rapid contractions of the sonic muscles attached to the lateral sides of their swim bladders (Bass et al. 1999). The female usually lays more than 100 eggs, which typically are attached to the underside of a rock, while the male fertilizes them (Arora 1948; Thompson et al. 1988). After depositing eggs, the female leaves the nest and the male remains and provides parental care. Care behaviour includes fanning the eggs until they hatch and then guarding the larvae until they become free-swimming in about 45 days (Arora 1948). Male plainfin midshipman are sexually dimorphic with two reproductive morphs known as type I and type II (Brantley and Bass 1994; Bass 1996). Type I males are territorial, acoustically court females and then provide parental care for the eggs and larvae. In contrast, type II males are smaller than type I males and frequently steal fertilizations using sneaking or female mimicry behaviour (Brantley et al. 1993; Brantley and Bass 1994; Bass 1996). Although type II males have sonic muscle with contractile apparatus, the ratio of sonic muscle mass to body mass is six times greater in type I males than in type II males; type II males do not hum but do occasionally produce low-amplitude grunts (Bass 1996; Lewis et al. 2003). Type II males also provide no care for their offspring, but instead leave that to the type I males that they parasitize. The plainfin midshipman fish thus provides an opportunity to assess the determinants and evolutionary consequences of alternative mating tactics. To date, however, the molecular markers essential for such studies have not been available. We now describe the development of eight novel and polymorphic microsatellites for this species. During June 2007, midshipman were sampled from three sites in the intertidal zone along Vancouver Island. Two sites, Ladysmith Inlet and Mill Bay, were on the east side of the island and separated by about 50 km. The third site, Bamfield Inlet, was on the west side of the island and separated from the other two by about 230 km (nautical distance). We first constructed a microsatellite DNA-enriched library following the method of Hamilton et al. (1999). Total genomic DNA was extracted from caudal peduncle tissue and digested with Hae III, Rsa I and Nhe I (New England Biolabs). Fragments 400–900 bp in length were ligated to a specific double-stranded linker (SNX; 5′-3′ forward: CTAAGGCCTTGCTAGCAGAAGC; reverse: GCTTCTGCTAGCAAGGCCTTAGAAAA) using T4 DNA ligase (New England Biolabs). The fragments were recovered by polymerase chain reaction (PCR) using the single-stranded forward and reverse linkers as primers. The PCR product was then hybridized to biotinylated (CT)12, (GT)12, (GATA)7, (GATC)7 and (GACA)7 probes. Bound fragments were recovered using streptavidin-coated magnetic beads (Dynabeads M-280 Streptavidin, New England Biolabs). DNA was amplified at 94°C for 10 min, followed by 35 cycles of 30 s at 94°C, 45 s at 58°C, 1 min at 72°C, and a final extension time of 72°C for 10 min using SNA forward primer. PCR products were ligated into the pGEM-T Easy Vector (Promega), transformed into competent Escherichia coli DH5α cells (Invitrogen), and spread onto LB agar plates. Approximately 300 positive clones were sequenced with T7 and SP6 universal primers at the Genome Quebec Innovation Centre (McGill University, Montreal, Canada). Sequences were used to design primers using Primo Pro 3.4 ( ). The loci were then initially screened with 11 individuals from the Ladysmith Inlet site. PCR amplifications were carried out in 10 μl reactions, containing ∼50 ng template DNA, 3 mM MgCl2, 1 × PCR buffer (Invitrogen Life Technologies), 0.25 mM of each deoxynucleotide (Sigma-Aldrich), 0.25 units Taq DNA polymerase (Invitrogen) and 0.25 μM of each forward and reverse primer. Forward primers were labeled with Beckman Dye D2, D3 and D4 (Sigma-Genosys, Woodland, TX, USA). Reactions were performed on T1 Thermocycler (Whatman-Biometra): 94°C for 10 min, 35 cycles of 30 s at 94°C, 30 s either at 58°C (Pon29) or 61°C (all other loci), 30 s at 72°C and final elongation at 72°C for 10 min. The fragment analyses were conducted on a CEQ 8000 (Beckman Coulter). The utility of the polymorphic loci was then examined using a broader sample of 63 individuals encompassing all three sampling sites. For each site, the observed and expected heterozygosity, Hardy-Weinberg equilibrium, and the linkage disequilibrium were calculated using Genepop version 3.4 (Raymond and Rousset 1995). The test for the presence of null alleles was conducted using MICRO-CHECKER ver. 2.2.3 (Van Oosterhout et al. 2004). Population differentiation among the three sites was examined using Genepop and pairwise FST estimates. Hierarchical genetic structuring was analyzed by assessing the relative contributions of among-population and within-population components using an analysis of molecular variance (AMOVA, Excoffier et al. 1992). The AMOVA was performed using the program Arlequin 2.0 (Schneider et al. 1997). Of the about 300 clones sequenced, sufficient flanking sequence was available to design primers for a total of 62 of the clones. Of these 62 loci, 34 (55%) did not amplify consistently, 18 (29%) were monomorphic, 2 (3%) were linked to other loci in our sample, and 8 (13%) amplified reliably and were polymorphic. Based on the larger sample of 63 individuals from three sites, the number of alleles for each locus ranged from three to 10; the observed and expected heterozygosity ranged from 0.30 to 1.00 and from 0.27 to 0.82, respectively (Table 1). Only one locus, Pon23, in Bamfield Inlet was found to be out of Hardy–Weinberg equilibrium following Bonferroni correction. As no deviation was found in the other two sites for Pon23, it is unlikely that the deviation at the Bamfield site was due to a null allele. No linkage was detected between any pair of the eight loci (χ2-tests p > 0.07). Interestingly, the three sites did not show any significant genetic differentiation (pairwise FST= 0.024–0.029; p > 0.09 for all comparisons), which suggests that the three sites may be derived from a single breeding population. The hierarchical AMOVA revealed that most of the genetic variance was found within populations compared to a smaller proportion among populations (percentage of variance; among populations: 2.6%, within populations: 97%, p < 0.05). The lack of detectable genetic divergence among the populations examined could relate to the frequent genetic exchange between the Georgia Straight and west coast of Vancouver Island. The population structure around Vancouver Island may be influenced by seasonal dispersal patterns. The bifurcation of the Subarctic Current off the west coast of Vancouver Island into the southerly flowing California Current and northerly flowing Alaska Current may allow differentiation of dispersal areas (Thomson et al. 1989), as has been reported in dungeness crab (Beacham et al. 2008). Additional surveys of other species are required to fully detail the genetic structure of populations in this area. Nevertheless, our data suggest little genetic structure in populations of plainfin midshipman fish around Vancouver Island. The eight loci developed here will be useful for broader analysis of population structure and gene flow, as well as for evaluation of reproductive success of males that utilize alterative mating tactics. Indeed, the eight loci have a single-parent and parent-pair exclusion probability of 0.90 and 0.99, respectively, which will allow accurate calculation of parentage in this system (Neff et al. 2000). The loci may also be useful in closely related species within the Batrachoididae. Nikita Eskin, Su Youn Baek, Susan Marsh Rollo, Chris Wood, Carol Bucking and Paul Craig provided assistance in the field or laboratory. Funding was provided by the Natural Sciences and Engineering Research Council of Canada, Canadian Foundation for Innovation, Ontario Innovation Trust, and the Univ. of Western Ontario.

Fetched live from OpenAlex and de-inverted. Abstracts are not stored in this database: the inverted indexes are 8.6 GB of the frame’s 9.3 GB of text, and the host has 13 GB free.

How this classification was reachedexpand

Full frame machine prediction

Teacher imitation

Not calibrated prevalence, not ground truth. Human validation pending. The Gemma side is a direct model label for every work in the frame, read from the title-only record. The Codex side is a classifier learned from the 10,348 direct Codex labels and calibrated to design-weighted sample rates; fields without enough sample support carry no Codex call. Candidate is the union of the two sides; consensus is their intersection. These outputs are machine_predicted_unvalidated and are not human labels.

metaresearch head score (Codex)0.000
metaresearch head score (Gemma)0.000
Version: metacan-v3-hybrid-931329e0061cValidation status: machine_predicted_unvalidated
Candidate categoriesnone
Consensus categoriesnone
DomainCandidate signal: none · Consensus signal: none
Study designCandidate signal: Observational · Consensus signal: Observational
GenreCandidate signal: Empirical · Consensus signal: Empirical
Teacher disagreement score0.004
Threshold uncertainty score0.009

Distilled classifier scores by category (both heads)

CategoryCodexGemma
Metaresearch0.0000.000
Meta-epidemiology (narrow)0.0000.000
Meta-epidemiology (broad)0.0000.000
Bibliometrics0.0010.001
Science and technology studies0.0000.000
Scholarly communication0.0000.000
Open science0.0000.000
Research integrity0.0000.000
Insufficient payload (model declined to judge)0.0010.000

Machine scores (provisional)

The two teacher heads of the student model, read on this work. A score orders the frame for review; it never asserts a category, and the validation status ships verbatim with every row.

Baseline scores from an immature model (maturity gate not passed, 7 training rounds). Scores rank; they never assert a category.

Opus teacher head0.007
GPT teacher head0.201
Teacher spread0.193 · how far apart the two teachers sit on this one work
Validation statusscore_only:v0-immature-baseline · verbatim from the scoring run: score_only means the number may rank works, and no category label ships from it

Classification

machine, unvalidated

Machine predicted; a candidate call from one source (direct Gemma or distilled Codex), not a consensus.

The models applied no category: nothing in the taxonomy fit this work.
Study designObservational
Domainnot available
GenreEmpirical

How this classification was reached, model by model and score by score, is at the end of the page under "How this classification was reached".

Quick stats

Citations8
Published2009
Admission routes3
Has abstractyes

Explore more

Same venueHereditasSame topicFish Ecology and Management StudiesFrench-language works237,207