First Report of Tomato leaf curl Palampur virus on Bitter Gourd in Pakistan
Notice bibliographique
Résumé
Bitter gourd (Momordica charantia L.) is widely grown and consumed as a vegetable in Pakistan and other countries in the region. In 2007, a severe disease appeared on bitter gourd that reduced yield significantly. Symptoms of the disease included chlorosis, leaf crumpling, vein thickening, and stunting of plants that were suggestive of a virus infection. Symptomatic leaf samples were collected from fields in the vicinity of Faisalabad, Pakistan (Thikriwala, 12 km from Faisalabad, 31°22'0″N, 72°53'0″E). Seven infected samples were tested for the presence of Zucchini yellow mosaic virus (ZYMV), Cucumber mosaic virus, Papaya ringspot virus, Melon necrotic spot virus, and Squash mosaic virus by double-antibody sandwich-ELISA according to the manufacturer's instructions (Bio-Rad, Hercules, CA). All samples of bitter gourd were found to be negative for all five RNA viruses, whereas melon samples collected from the same area (Thikriwala) were infected by ZYMV as reported earlier (3). Samples were also screened for begomoviruses by molecular tests. Total DNA was extracted with the cetyltrimethylammoniumbromide method (4). All seven symptomatic samples were positive for a begomovirus when DNA A of Tomato leaf curl New Delhi virus (ToLCNDV) was used as a general probe by Southern hybridization. A probe of the movement protein (MP) gene of ToLCNDV was also positive by Southern hybridization, suggesting the infection of a bipartite begomovirus. The presence of a begomovirus was confirmed by PCR with universal primers designed for amplification of begomoviruses (BegomoRe F 5'ACGCGT GCCGTGCTGCTGCCCCCATTGTCC3' and BegomoRe R 5'ACGCGT ATGGGCTGYCGAAGTTSAGACG3'). A fragment of the expected length (approximately 2.8 kb) was cloned in a T/A cloning vector (ptz57R/t; Fermentas, Burlington, Ontario, Canada) and partially sequenced. Sequence analysis of partial sequences (925 bp, GenBank Accession No. FN555137; 719 bp, GenBank Accession No. FN555138) showed maximum identity (97%) with Tomato leaf curl Palampur virus (ToLCPaV) recently reported from India and Iran (1,2). To our knowledge, this is the first report of ToLCPaV in Pakistan and the first report of the virus on bitter gourd. References: (1) J. Heydarnejad et al. Arch. Virol. 154:1015, 2009. (2) Y. Kumar et al. Virus Genes 38:193, 2009. (3) A. H. Malik et al. Plant Pathol. 55:285, 2006. (4) M. G. Murray and W. F. Thompson. Nucleic Acids Res.8:4321, 1980.
Récupéré en direct depuis OpenAlex et désinversé. Les résumés ne sont pas conservés dans cette base de données : les index inversés représentent 8,6 Go des 9,3 Go de texte de la base, et le serveur dispose de 13 Go libres.
Comment cette classification a été obtenuedéplier
Prédiction machine sur la base complète
Imitation des enseignantsNi prévalence calibrée, ni vérité terrain. Validation humaine à venir. Le volet Gemma est une étiquette directe du modèle pour chaque travail de la base, lue sur la notice réduite au titre. Le volet Codex est un classifieur appris des 10 348 étiquettes directes de Codex et calibré sur les taux pondérés de l'échantillon; les champs sans appui suffisant ne portent aucun appel Codex. Le mode candidate est l'union des deux volets; le consensus est leur intersection. Ces sorties portent le statut machine_predicted_unvalidated et ne sont pas des étiquettes humaines.
Scores du classifieur distillé par catégorie (deux têtes)
| Catégorie | Codex | Gemma |
|---|---|---|
| Métarecherche | 0,000 | 0,000 |
| Méta-épidémiologie (sens strict) | 0,001 | 0,000 |
| Méta-épidémiologie (sens large) | 0,000 | 0,000 |
| Bibliométrie | 0,001 | 0,000 |
| Études des sciences et des technologies | 0,002 | 0,001 |
| Communication savante | 0,001 | 0,000 |
| Science ouverte | 0,000 | 0,000 |
| Intégrité de la recherche | 0,001 | 0,001 |
| Charge utile insuffisante (le modèle a refusé de juger) | 0,002 | 0,001 |
Scores machine (provisoires)
Les deux têtes enseignantes du modèle étudiant, lues sur ce travail. Un score ordonne la base pour la relecture; il n'affirme jamais une catégorie, et le statut de validation accompagne chaque rangée tel quel.
Scores de référence d'un modèle non mature (critères de maturité non atteints, 7 itérations). Un score ordonne; il n'affirme jamais une catégorie.
score_only:v0-immature-baseline · tel quel depuis la passe de notation : score_only signifie que le nombre peut ordonner les travaux, et qu'aucune étiquette de catégorie n'en découleClassification
machine, non validéePrédiction automatique; un appel candidat d’une seule source (Gemma direct ou Codex distillé), pas un consensus.
Le détail, modèle par modèle et score par score, se trouve en fin de page sous « Comment cette classification a été obtenue ».