First Report of Tomato leaf curl Palampur virus on Bitter Gourd in Pakistan
Bibliographic record
Abstract
Bitter gourd (Momordica charantia L.) is widely grown and consumed as a vegetable in Pakistan and other countries in the region. In 2007, a severe disease appeared on bitter gourd that reduced yield significantly. Symptoms of the disease included chlorosis, leaf crumpling, vein thickening, and stunting of plants that were suggestive of a virus infection. Symptomatic leaf samples were collected from fields in the vicinity of Faisalabad, Pakistan (Thikriwala, 12 km from Faisalabad, 31°22'0″N, 72°53'0″E). Seven infected samples were tested for the presence of Zucchini yellow mosaic virus (ZYMV), Cucumber mosaic virus, Papaya ringspot virus, Melon necrotic spot virus, and Squash mosaic virus by double-antibody sandwich-ELISA according to the manufacturer's instructions (Bio-Rad, Hercules, CA). All samples of bitter gourd were found to be negative for all five RNA viruses, whereas melon samples collected from the same area (Thikriwala) were infected by ZYMV as reported earlier (3). Samples were also screened for begomoviruses by molecular tests. Total DNA was extracted with the cetyltrimethylammoniumbromide method (4). All seven symptomatic samples were positive for a begomovirus when DNA A of Tomato leaf curl New Delhi virus (ToLCNDV) was used as a general probe by Southern hybridization. A probe of the movement protein (MP) gene of ToLCNDV was also positive by Southern hybridization, suggesting the infection of a bipartite begomovirus. The presence of a begomovirus was confirmed by PCR with universal primers designed for amplification of begomoviruses (BegomoRe F 5'ACGCGT GCCGTGCTGCTGCCCCCATTGTCC3' and BegomoRe R 5'ACGCGT ATGGGCTGYCGAAGTTSAGACG3'). A fragment of the expected length (approximately 2.8 kb) was cloned in a T/A cloning vector (ptz57R/t; Fermentas, Burlington, Ontario, Canada) and partially sequenced. Sequence analysis of partial sequences (925 bp, GenBank Accession No. FN555137; 719 bp, GenBank Accession No. FN555138) showed maximum identity (97%) with Tomato leaf curl Palampur virus (ToLCPaV) recently reported from India and Iran (1,2). To our knowledge, this is the first report of ToLCPaV in Pakistan and the first report of the virus on bitter gourd. References: (1) J. Heydarnejad et al. Arch. Virol. 154:1015, 2009. (2) Y. Kumar et al. Virus Genes 38:193, 2009. (3) A. H. Malik et al. Plant Pathol. 55:285, 2006. (4) M. G. Murray and W. F. Thompson. Nucleic Acids Res.8:4321, 1980.
Fetched live from OpenAlex and de-inverted. Abstracts are not stored in this database: the inverted indexes are 8.6 GB of the frame’s 9.3 GB of text, and the host has 13 GB free.
How this classification was reachedexpand
Full frame machine prediction
Teacher imitationNot calibrated prevalence, not ground truth. Human validation pending. The Gemma side is a direct model label for every work in the frame, read from the title-only record. The Codex side is a classifier learned from the 10,348 direct Codex labels and calibrated to design-weighted sample rates; fields without enough sample support carry no Codex call. Candidate is the union of the two sides; consensus is their intersection. These outputs are machine_predicted_unvalidated and are not human labels.
Distilled classifier scores by category (both heads)
| Category | Codex | Gemma |
|---|---|---|
| Metaresearch | 0.000 | 0.000 |
| Meta-epidemiology (narrow) | 0.001 | 0.000 |
| Meta-epidemiology (broad) | 0.000 | 0.000 |
| Bibliometrics | 0.001 | 0.000 |
| Science and technology studies | 0.002 | 0.001 |
| Scholarly communication | 0.001 | 0.000 |
| Open science | 0.000 | 0.000 |
| Research integrity | 0.001 | 0.001 |
| Insufficient payload (model declined to judge) | 0.002 | 0.001 |
Machine scores (provisional)
The two teacher heads of the student model, read on this work. A score orders the frame for review; it never asserts a category, and the validation status ships verbatim with every row.
Baseline scores from an immature model (maturity gate not passed, 7 training rounds). Scores rank; they never assert a category.
score_only:v0-immature-baseline · verbatim from the scoring run: score_only means the number may rank works, and no category label ships from itClassification
machine, unvalidatedMachine predicted; a candidate call from one source (direct Gemma or distilled Codex), not a consensus.
How this classification was reached, model by model and score by score, is at the end of the page under "How this classification was reached".