MétaCan
Menu
Retour à la cohorte
Enregistrement W2163956153 · doi:10.1094/pdis-02-12-0166-pdn

First Report of Pitch Canker Disease Caused by <i>Rhizosphaera kalkhoffii</i> on <i>Pinus sylvestris</i> in China

2012· article· en· W2163956153 sur OpenAlexaff
Chongjuan You, Chengming Tian, Yan-Jun Liang, Xuezhi Dong, Clement K. M. Tsui

Notice bibliographique

RevuePlant Disease · 2012
Typearticle
Langueen
DomaineBiochemistry, Genetics and Molecular Biology
ThématiquePlant Pathogens and Fungal Diseases
Établissements canadiensUniversity of British Columbia
Organismes subventionnairesnon disponible
Mots-clésCankerBiologyPotato dextrose agarConidiumMyceliumInternal transcribed spacerBotanyBark (sound)InoculationHorticultureRibosomal RNAGeneAgarBacteria

Résumé

récupéré en direct d'OpenAlex

In November 2010, pitch canker disease was first discovered on Pinus sylvestris var. mongolica Litv. from Daxinganling region in Inner Mongolia Province, China, resulting in severe dieback and bark cracking on the host, accompanied by resin flowing profusely from cankers on the infected branches, cones, and trunks (2). The early stage symptoms consisted of sunken cankers, reddish-brown needles on infected twigs followed by heavy resin soaking of the wood as the disease progressed. Pieces of pitch-soaked wood (3 × 3 mm2) cut from cankerous tissue on branches were surface-sterilized with 0.4% NaOCl for 2 min and then rinsed twice in sterile distilled water. The fragments were placed on potato dextrose agar and incubated at 28°C in the dark. After 7 to 8 days, this process consistently yielded cultures with whitish, dense, aerial mycelium that later darkened to gray. Microconidia were single, oblong to cylindrical, aseptate, and 4 to 10 × 2 to 4 μm. Macroconidia were hyaline, 1- to 2-septate, oblong to cylindrical, with tiny papillae at both ends, and 10 to 13 × 2 to 5 μm, fitting the description of Rhizosphaera kalkhoffii (1). To verify the identification based on morphological features, the internal transcribed spacer (ITS) region of the ribosomal RNA genes was amplified using primers ITS1 (TCCGTAGGTGAACCTGCGG) and ITS4 (TCCTCCGCTTATTGATATGC) according to the published protocol (3), and then sequenced and compared to the GenBank database through BLAST search. Comparison of the sequences revealed 98% homology to R. kalkhoffii (EU700375.1 and EU700376.1). Representative sequences of R. kalkhoffii (JQ353721 and JQ353722) were deposited in GenBank. The pathogenicity of two representative isolates of R. kalkhoffii was also confirmed by spraying 40 μl of conidial suspension (4.6 × 106 conidia/ml) on the bark surface of 20 2-year-old healthy pine seedlings, wounded by scratching with a sterilized knife. Sterile distilled water sprays were used for the controls. Within 4 to 8 weeks after inoculation, 90% of inoculated P. sylvestris exhibited symptoms of pitch cankers around the inoculation site similar to those on the original infection. R. kalkhoffii was consistently reisolated from all inoculated plants but not from water-treated controls, fulfilling Koch's postulates. R. kalkhoffii have previously been documented as pathogens of needle blight of Picea pungens (1). To our knowledge, this is the first report of R. kalkhoffii as a pathogen on Pinus sylvestris in China, and furthermore, pitch canker disease is currently listed as a quarantine disease in China, increasing the significance of this report. References: (1) J. Kumi et al. Eur. J. Forest Pathol. 9:35, 1979. (2) J. K. Lee et al. Plant Pathol. 16:52, 2000. (3) T. J. White et al. Page 315 in: PCR Protocols: A Guide to Methods and Applications. Academic Press, San Diego, CA, 1990.

Récupéré en direct depuis OpenAlex et désinversé. Les résumés ne sont pas conservés dans cette base de données : les index inversés représentent 8,6 Go des 9,3 Go de texte de la base, et le serveur dispose de 13 Go libres.

Comment cette classification a été obtenuedéplier

Prédiction machine sur la base complète

Imitation des enseignants

Ni prévalence calibrée, ni vérité terrain. Validation humaine à venir. Le volet Gemma est une étiquette directe du modèle pour chaque travail de la base, lue sur la notice réduite au titre. Le volet Codex est un classifieur appris des 10 348 étiquettes directes de Codex et calibré sur les taux pondérés de l'échantillon; les champs sans appui suffisant ne portent aucun appel Codex. Le mode candidate est l'union des deux volets; le consensus est leur intersection. Ces sorties portent le statut machine_predicted_unvalidated et ne sont pas des étiquettes humaines.

score de la tête « metaresearch » (Codex)0,000
score de la tête « metaresearch » (Gemma)0,000
Version: metacan-v3-hybrid-931329e0061cStatut de validation: machine_predicted_unvalidated
Catégories candidatesaucune
Catégories consensuellesaucune
DomaineSignal candidat: aucune · Signal consensuel: aucune
Devis d'étudeSignal candidat: Étude de cas · Signal consensuel: aucune
GenreSignal candidat: Empirique · Signal consensuel: Empirique
Score de désaccord entre enseignants0,018
Score d'incertitude au seuil0,036

Scores du classifieur distillé par catégorie (deux têtes)

CatégorieCodexGemma
Métarecherche0,0000,000
Méta-épidémiologie (sens strict)0,0010,000
Méta-épidémiologie (sens large)0,0000,000
Bibliométrie0,0010,000
Études des sciences et des technologies0,0010,000
Communication savante0,0000,000
Science ouverte0,0000,000
Intégrité de la recherche0,0000,000
Charge utile insuffisante (le modèle a refusé de juger)0,0010,000

Scores machine (provisoires)

Les deux têtes enseignantes du modèle étudiant, lues sur ce travail. Un score ordonne la base pour la relecture; il n'affirme jamais une catégorie, et le statut de validation accompagne chaque rangée tel quel.

Scores de référence d'un modèle non mature (critères de maturité non atteints, 7 itérations). Un score ordonne; il n'affirme jamais une catégorie.

Tête enseignante Opus0,007
Tête enseignante GPT0,212
Écart entre enseignants0,205 · la distance entre les deux têtes enseignantes sur ce seul travail
Statut de validationscore_only:v0-immature-baseline · tel quel depuis la passe de notation : score_only signifie que le nombre peut ordonner les travaux, et qu'aucune étiquette de catégorie n'en découle

Classification

machine, non validée

Prédiction automatique; un appel candidat d’une seule source (Gemma direct ou Codex distillé), pas un consensus.

Les modèles n’ont appliqué aucune catégorie : rien dans la taxonomie ne correspondait à ce travail.
Devis d'étudeÉtude de cas
Domainenon disponible
GenreEmpirique

Le détail, modèle par modèle et score par score, se trouve en fin de page sous « Comment cette classification a été obtenue ».

En bref

Citations1
Publié2012
Routes d'admission1
Résumé présentoui

Explorer davantage

Même revuePlant DiseaseMême sujetPlant Pathogens and Fungal DiseasesTravaux en français237 207