MétaCan
Menu
Back to cohort
Record W2163956153 · doi:10.1094/pdis-02-12-0166-pdn

First Report of Pitch Canker Disease Caused by <i>Rhizosphaera kalkhoffii</i> on <i>Pinus sylvestris</i> in China

2012· article· en· W2163956153 on OpenAlexaff
Chongjuan You, Chengming Tian, Yan-Jun Liang, Xuezhi Dong, Clement K. M. Tsui

Bibliographic record

VenuePlant Disease · 2012
Typearticle
Languageen
FieldBiochemistry, Genetics and Molecular Biology
TopicPlant Pathogens and Fungal Diseases
Canadian institutionsUniversity of British Columbia
Fundersnot available
KeywordsCankerBiologyPotato dextrose agarConidiumMyceliumInternal transcribed spacerBotanyBark (sound)InoculationHorticultureRibosomal RNAGeneAgarBacteria

Abstract

fetched live from OpenAlex

In November 2010, pitch canker disease was first discovered on Pinus sylvestris var. mongolica Litv. from Daxinganling region in Inner Mongolia Province, China, resulting in severe dieback and bark cracking on the host, accompanied by resin flowing profusely from cankers on the infected branches, cones, and trunks (2). The early stage symptoms consisted of sunken cankers, reddish-brown needles on infected twigs followed by heavy resin soaking of the wood as the disease progressed. Pieces of pitch-soaked wood (3 × 3 mm2) cut from cankerous tissue on branches were surface-sterilized with 0.4% NaOCl for 2 min and then rinsed twice in sterile distilled water. The fragments were placed on potato dextrose agar and incubated at 28°C in the dark. After 7 to 8 days, this process consistently yielded cultures with whitish, dense, aerial mycelium that later darkened to gray. Microconidia were single, oblong to cylindrical, aseptate, and 4 to 10 × 2 to 4 μm. Macroconidia were hyaline, 1- to 2-septate, oblong to cylindrical, with tiny papillae at both ends, and 10 to 13 × 2 to 5 μm, fitting the description of Rhizosphaera kalkhoffii (1). To verify the identification based on morphological features, the internal transcribed spacer (ITS) region of the ribosomal RNA genes was amplified using primers ITS1 (TCCGTAGGTGAACCTGCGG) and ITS4 (TCCTCCGCTTATTGATATGC) according to the published protocol (3), and then sequenced and compared to the GenBank database through BLAST search. Comparison of the sequences revealed 98% homology to R. kalkhoffii (EU700375.1 and EU700376.1). Representative sequences of R. kalkhoffii (JQ353721 and JQ353722) were deposited in GenBank. The pathogenicity of two representative isolates of R. kalkhoffii was also confirmed by spraying 40 μl of conidial suspension (4.6 × 106 conidia/ml) on the bark surface of 20 2-year-old healthy pine seedlings, wounded by scratching with a sterilized knife. Sterile distilled water sprays were used for the controls. Within 4 to 8 weeks after inoculation, 90% of inoculated P. sylvestris exhibited symptoms of pitch cankers around the inoculation site similar to those on the original infection. R. kalkhoffii was consistently reisolated from all inoculated plants but not from water-treated controls, fulfilling Koch's postulates. R. kalkhoffii have previously been documented as pathogens of needle blight of Picea pungens (1). To our knowledge, this is the first report of R. kalkhoffii as a pathogen on Pinus sylvestris in China, and furthermore, pitch canker disease is currently listed as a quarantine disease in China, increasing the significance of this report. References: (1) J. Kumi et al. Eur. J. Forest Pathol. 9:35, 1979. (2) J. K. Lee et al. Plant Pathol. 16:52, 2000. (3) T. J. White et al. Page 315 in: PCR Protocols: A Guide to Methods and Applications. Academic Press, San Diego, CA, 1990.

Fetched live from OpenAlex and de-inverted. Abstracts are not stored in this database: the inverted indexes are 8.6 GB of the frame’s 9.3 GB of text, and the host has 13 GB free.

How this classification was reachedexpand

Full frame machine prediction

Teacher imitation

Not calibrated prevalence, not ground truth. Human validation pending. The Gemma side is a direct model label for every work in the frame, read from the title-only record. The Codex side is a classifier learned from the 10,348 direct Codex labels and calibrated to design-weighted sample rates; fields without enough sample support carry no Codex call. Candidate is the union of the two sides; consensus is their intersection. These outputs are machine_predicted_unvalidated and are not human labels.

metaresearch head score (Codex)0.000
metaresearch head score (Gemma)0.000
Version: metacan-v3-hybrid-931329e0061cValidation status: machine_predicted_unvalidated
Candidate categoriesnone
Consensus categoriesnone
DomainCandidate signal: none · Consensus signal: none
Study designCandidate signal: Case report · Consensus signal: none
GenreCandidate signal: Empirical · Consensus signal: Empirical
Teacher disagreement score0.018
Threshold uncertainty score0.036

Distilled classifier scores by category (both heads)

CategoryCodexGemma
Metaresearch0.0000.000
Meta-epidemiology (narrow)0.0010.000
Meta-epidemiology (broad)0.0000.000
Bibliometrics0.0010.000
Science and technology studies0.0010.000
Scholarly communication0.0000.000
Open science0.0000.000
Research integrity0.0000.000
Insufficient payload (model declined to judge)0.0010.000

Machine scores (provisional)

The two teacher heads of the student model, read on this work. A score orders the frame for review; it never asserts a category, and the validation status ships verbatim with every row.

Baseline scores from an immature model (maturity gate not passed, 7 training rounds). Scores rank; they never assert a category.

Opus teacher head0.007
GPT teacher head0.212
Teacher spread0.205 · how far apart the two teachers sit on this one work
Validation statusscore_only:v0-immature-baseline · verbatim from the scoring run: score_only means the number may rank works, and no category label ships from it

Classification

machine, unvalidated

Machine predicted; a candidate call from one source (direct Gemma or distilled Codex), not a consensus.

The models applied no category: nothing in the taxonomy fit this work.
Study designCase report
Domainnot available
GenreEmpirical

How this classification was reached, model by model and score by score, is at the end of the page under "How this classification was reached".

Quick stats

Citations1
Published2012
Admission routes1
Has abstractyes

Explore more

Same venuePlant DiseaseSame topicPlant Pathogens and Fungal DiseasesFrench-language works237,207