PKC δ Inhibition Restores PTEN Activity in Myeloma Cells and Prolongs Survival of GFP+ Myeloma SCID/NOD Mice In Vivo.
Notice bibliographique
Résumé
Abstract PTEN, a cellular phosphatase involved in the regulation of phosphatidylinositol phosphates (PIPs), is often inactivated in myeloma cells either through gene mutation or via phosphorylation of serine and threonine residues in the PTEN C-terminal domain that also results in loss of its activity and stability. The loss of PTEN function results in a failure to de-phosphorylate PIPs with a corresponding increase in Akt kinase activity. We have recently reported that PKCδ inhibition with Rottlerin (3 μM) induces cell death in sensitive and resistant myeloma cell lines (MM1S, MM1R, 8226S and U266) (Blood2002,100,11,393a). In addition Rottlerin blocked constitutive as well as IGF-1 induced phosphorylation of Akt abrogating its kinase activity and suppresses the phosphorylation of FKHR, GSK 3α/β and Bad, downstream substrates of Akt, triggerring activation of the intrinsic apoptotic pathway with loss of the mitochondrial membrane potential (Δψ) and cleavage of caspases 9, 3 and PARP. PKCδ inhibition also suppressed, upstream of Akt, ser 241-PDK1 phosphorylation by PIPs. These findings led us to investigate the PTEN status in human myeloma cell lines (MM1S, 8226S and U266). While normal PTEN expression was detected in these cell lines, PTEN was universally phosphorylated on ser 380 in its C-terminal domain, resulting in loss of its activity. Rottlerin completely suppressed the phosphorylation of this serine residue, restoring PTEN function and dephosphorylating PIPs. In order to verify that Rottlerin exhibited its effects by inhibiting PKCδ, we first stably overexpressed PKCδ in the 8226S cells. PKCδ overexpression partially protected these cells against rotttlerin cytotoxicity and abrogated rottlerin induced AKT inhibition and PTEN activation. Furthermore transfection of 8226S cells with a mammalian PKCδ siRNA expression plasmid (sense strand of shRNA: 5′_AAGAACGCTTCAACATCGACATTCAAGATGCGATGTTGAAGCGTTCTTTTTTTG_3′expression plasmid) reduced PKCδ expression by nearly 90% and more importantly it reduced PTEN, Akt and GSK 3α/β phosphorylation. Finally, we examined the effect of Rottlerin on the viability of GFP+ myeloma SCID/NOD mice in vivo. 4 to 6 weeks old SCID/NOD mice were irradiated (300 rads) and 24 h later received tail vein injections of 5 x 106 RPMI-8226/S-GFP+ cells. Treatment with Rottlerin (3mg/kg ip) every other day was effective in slowing tumor growth as monitored by whole-body real-time fluorescence imaging and prolonged median survival of GFP+ myeloma SCID/NOD mice compared to a non-treated control cohort. In summary, our work provides evidence that PKCδ inhibition restores PTEN function in wild type PTEN expressing myeloma cells and is a valid biological target for the treatment of multiple myeloma.
Récupéré en direct depuis OpenAlex et désinversé. Les résumés ne sont pas conservés dans cette base de données : les index inversés représentent 8,6 Go des 9,3 Go de texte de la base, et le serveur dispose de 13 Go libres.
Comment cette classification a été obtenuedéplier
Prédiction machine sur la base complète
Imitation des enseignantsNi prévalence calibrée, ni vérité terrain. Validation humaine à venir. Le volet Gemma est une étiquette directe du modèle pour chaque travail de la base, lue sur la notice réduite au titre. Le volet Codex est un classifieur appris des 10 348 étiquettes directes de Codex et calibré sur les taux pondérés de l'échantillon; les champs sans appui suffisant ne portent aucun appel Codex. Le mode candidate est l'union des deux volets; le consensus est leur intersection. Ces sorties portent le statut machine_predicted_unvalidated et ne sont pas des étiquettes humaines.
Scores du classifieur distillé par catégorie (deux têtes)
| Catégorie | Codex | Gemma |
|---|---|---|
| Métarecherche | 0,000 | 0,000 |
| Méta-épidémiologie (sens strict) | 0,001 | 0,000 |
| Méta-épidémiologie (sens large) | 0,000 | 0,000 |
| Bibliométrie | 0,001 | 0,000 |
| Études des sciences et des technologies | 0,000 | 0,000 |
| Communication savante | 0,000 | 0,000 |
| Science ouverte | 0,000 | 0,000 |
| Intégrité de la recherche | 0,000 | 0,001 |
| Charge utile insuffisante (le modèle a refusé de juger) | 0,002 | 0,001 |
Scores machine (provisoires)
Les deux têtes enseignantes du modèle étudiant, lues sur ce travail. Un score ordonne la base pour la relecture; il n'affirme jamais une catégorie, et le statut de validation accompagne chaque rangée tel quel.
Scores de référence d'un modèle non mature (critères de maturité non atteints, 7 itérations). Un score ordonne; il n'affirme jamais une catégorie.
score_only:v0-immature-baseline · tel quel depuis la passe de notation : score_only signifie que le nombre peut ordonner les travaux, et qu'aucune étiquette de catégorie n'en découleClassification
machine, non validéePrédiction automatique; un appel candidat d’une seule source (Gemma direct ou Codex distillé), pas un consensus.
Le détail, modèle par modèle et score par score, se trouve en fin de page sous « Comment cette classification a été obtenue ».