PKC δ Inhibition Restores PTEN Activity in Myeloma Cells and Prolongs Survival of GFP+ Myeloma SCID/NOD Mice In Vivo.

Abstract PTEN, a cellular phosphatase involved in the regulation of phosphatidylinositol phosphates (PIPs), is often inactivated in myeloma cells either through gene mutation or via phosphorylation of serine and threonine residues in the PTEN C-terminal domain that also results in loss of its activity and stability. The loss of PTEN function results in a failure to de-phosphorylate PIPs with a corresponding increase in Akt kinase activity. We have recently reported that PKCδ inhibition with Rottlerin (3 μM) induces cell death in sensitive and resistant myeloma cell lines (MM1S, MM1R, 8226S and U266) (Blood2002,100,11,393a). In addition Rottlerin blocked constitutive as well as IGF-1 induced phosphorylation of Akt abrogating its kinase activity and suppresses the phosphorylation of FKHR, GSK 3α/β and Bad, downstream substrates of Akt, triggerring activation of the intrinsic apoptotic pathway with loss of the mitochondrial membrane potential (Δψ) and cleavage of caspases 9, 3 and PARP. PKCδ inhibition also suppressed, upstream of Akt, ser 241-PDK1 phosphorylation by PIPs. These findings led us to investigate the PTEN status in human myeloma cell lines (MM1S, 8226S and U266). While normal PTEN expression was detected in these cell lines, PTEN was universally phosphorylated on ser 380 in its C-terminal domain, resulting in loss of its activity. Rottlerin completely suppressed the phosphorylation of this serine residue, restoring PTEN function and dephosphorylating PIPs. In order to verify that Rottlerin exhibited its effects by inhibiting PKCδ, we first stably overexpressed PKCδ in the 8226S cells. PKCδ overexpression partially protected these cells against rotttlerin cytotoxicity and abrogated rottlerin induced AKT inhibition and PTEN activation. Furthermore transfection of 8226S cells with a mammalian PKCδ siRNA expression plasmid (sense strand of shRNA: 5′_AAGAACGCTTCAACATCGACATTCAAGATGCGATGTTGAAGCGTTCTTTTTTTG_3′expression plasmid) reduced PKCδ expression by nearly 90% and more importantly it reduced PTEN, Akt and GSK 3α/β phosphorylation. Finally, we examined the effect of Rottlerin on the viability of GFP+ myeloma SCID/NOD mice in vivo. 4 to 6 weeks old SCID/NOD mice were irradiated (300 rads) and 24 h later received tail vein injections of 5 x 106 RPMI-8226/S-GFP+ cells. Treatment with Rottlerin (3mg/kg ip) every other day was effective in slowing tumor growth as monitored by whole-body real-time fluorescence imaging and prolonged median survival of GFP+ myeloma SCID/NOD mice compared to a non-treated control cohort. In summary, our work provides evidence that PKCδ inhibition restores PTEN function in wild type PTEN expressing myeloma cells and is a valid biological target for the treatment of multiple myeloma.

Fetched live from OpenAlex and de-inverted. Abstracts are not stored in this database: the inverted indexes are 8.6 GB of the frame’s 9.3 GB of text, and the host has 13 GB free.