MétaCan
Menu
Retour à la cohorte
Enregistrement W3086330617 · doi:10.1094/pdis-07-20-1566-pdn

First Report of Grapevine Asteroid Mosaic Associated Virus in Grapevine in Spain

2020· article· en· W3086330617 sur OpenAlexaboutno aff
Félix Morán, Célia Canales, Antonio Olmos, Ana Belén Ruiz-García

Notice bibliographique

RevuePlant Disease · 2020
Typearticle
Langueen
DomaineAgricultural and Biological Sciences
ThématiquePlant Virus Research Studies
Établissements canadiensnon disponible
Organismes subventionnairesnon disponible
Mots-clésBiologyContigSequence assemblyGenomeVirusReference genomeVirologyBotanyGeneticsGeneTranscriptome

Résumé

récupéré en direct d'OpenAlex

Grapevine asteroid mosaic associated virus (GAMaV) is a member of the genus Marafivirus, family Tymoviridae. GAMaV was initially found to infect grapevine (Vitis vinifera) in California and was also reported in Japan, Canada, Uruguay, France, Hungary and Italy (Nakaune et al. 2008; Vargas-Asencio et al. 2017; Candresse et al. 2017; Porceddu et al. 2018). In July 2019 a grapevine sample from cv. Tempranillo (TS1), collected in a random survey from a vineyard in a Spanish grapevine growing area (D.O. Utiel-Requena), showing chlorotic mottling and leaf deformations, was analyzed by high throughput sequencing (HTS). Total RNA extracted from leaves was sequenced after ribo-depletion (Ribo-Zero Plant kit, Illumina) using TrueSeq Illumina technology (150 nt pair-end reads). Data analysis was performed by CLC Genomics Workbench 10.1.1. After quality control and host genome subtraction 2,410,654 reads were used for de novo assembly. BLAST analysis of the 13,303 contigs obtained revealed the presence of four contigs (2736, 1448, 1285 and 954 nt in size) related to GAMaV, indicating the presence of this virus in TS1 sample. Contigs related to other viruses/viroids were also found, in particular Grapevine rupestris stem pitting-associated virus, Grapevine leafroll-associated virus 3, Grapevine virus A, Grapevine fleck virus, Grapevine red globe virus, Grapevine rupestris vein feathering virus and Hop stunt viroid. For the assembly of the full-length GAMaV genome, contigs were extended by mapping the reads against the contigs using Geneious Prime 2020 software. This mapping step allowed the recovery of the GAMaV genomic sequence (635 reads, average coverage per nucleotide 10.0) with the exception of a small gap of 147 nt in the helicase region of the polyprotein. The gap in the genomic region was covered by RT-PCR using two newly designed primers overlapping the flanking regions (GAMaV-3755-F, 5'ATCCTCACCAACTCCC3' and GAMaV-3985-R, 5'GTTGGAAGTGGTGTG3'). Nearly complete sequence of the isolate TS1 (6,692 nt, MT459830) showed 87.7% nucleotide identity with the isolate 16GVP031 (MK253012) from France. The phylogenetic analysis performed on the available GAMaV full-length genomes showed that the Spanish isolate was positioned in a distinct clade (Supp. Fig. 1). The presence of GAMaV in Spain was further evaluated by reverse transcription-polymerase chain reaction (RT-PCR). Specific GAMaV primers, GAMaV-F3 and GAMaV-R3 previously reported by Candresse et al. (2017) were used without any success, due to primer mismatching. Based on TS1 sequence, two primers (GAMaV-6010F, 5'CCCTCCTCCTAGCGACGACC3' and GAMaV-6426R, 5'GGGTTGAGACGGCGGAGATC3') were designed and used to amplify a fragment of 417 nt in the CP region. Sanger sequencing of the obtained RT-PCR product confirmed the HTS recovered sequence. A total of 52 randomly collected samples from the same grapevine growing area were analyzed by RT-PCR using the newly designed primers. One sample bearing similar symptoms, TS7 (MT770919, cv. Tempranillo), and eight symptomless samples, MS1, MS2 and MS3 (MT770911, MT770917 and MT770918, cv. Macabeo), and TS2, TS3, TS4, TS5 and TS6 (MT770912, MT770913, MT770914, MT770915 and MT770916, cv. Tempranillo), tested positive for GAMaV, thus confirming its presence in Spanish vineyards. The nucleotide identity between these partial sequences and the homologous region of TS1 ranged from 94.7% to 98.8%, 0.04 being the mean diversity among isolates at the CP genomic region estimated by MEGA X software. To our knowledge, this is the first report of GAMaV in grapevine in Spain. The presence of other viruses/viroids in TS1 sample and the finding of asymptomatic GAMaV infected plants make difficult to associate this virus to the observed symptomatology. Other latent or semilatent GAMaV infections have been previously reported (Martelli 2014; Candresse et al. 2017).

Récupéré en direct depuis OpenAlex et désinversé. Les résumés ne sont pas conservés dans cette base de données : les index inversés représentent 8,6 Go des 9,3 Go de texte de la base, et le serveur dispose de 13 Go libres.

Comment cette classification a été obtenuedéplier

Prédiction machine sur la base complète

Imitation des enseignants

Ni prévalence calibrée, ni vérité terrain. Validation humaine à venir. Le volet Gemma est une étiquette directe du modèle pour chaque travail de la base, lue sur la notice réduite au titre. Le volet Codex est un classifieur appris des 10 348 étiquettes directes de Codex et calibré sur les taux pondérés de l'échantillon; les champs sans appui suffisant ne portent aucun appel Codex. Le mode candidate est l'union des deux volets; le consensus est leur intersection. Ces sorties portent le statut machine_predicted_unvalidated et ne sont pas des étiquettes humaines.

score de la tête « metaresearch » (Codex)0,001
score de la tête « metaresearch » (Gemma)0,001
Version: metacan-v3-hybrid-931329e0061cStatut de validation: machine_predicted_unvalidated
Catégories candidatesaucune
Catégories consensuellesaucune
DomaineSignal candidat: aucune · Signal consensuel: aucune
Devis d'étudeSignal candidat: Étude de cas · Signal consensuel: aucune
GenreSignal candidat: Empirique · Signal consensuel: Empirique
Score de désaccord entre enseignants0,019
Score d'incertitude au seuil0,039

Scores du classifieur distillé par catégorie (deux têtes)

CatégorieCodexGemma
Métarecherche0,0010,001
Méta-épidémiologie (sens strict)0,0010,000
Méta-épidémiologie (sens large)0,0010,001
Bibliométrie0,0020,001
Études des sciences et des technologies0,0010,000
Communication savante0,0030,000
Science ouverte0,0010,001
Intégrité de la recherche0,0010,001
Charge utile insuffisante (le modèle a refusé de juger)0,0010,001

Scores machine (provisoires)

Les deux têtes enseignantes du modèle étudiant, lues sur ce travail. Un score ordonne la base pour la relecture; il n'affirme jamais une catégorie, et le statut de validation accompagne chaque rangée tel quel.

Scores de référence d'un modèle non mature (critères de maturité non atteints, 7 itérations). Un score ordonne; il n'affirme jamais une catégorie.

Tête enseignante Opus0,042
Tête enseignante GPT0,243
Écart entre enseignants0,201 · la distance entre les deux têtes enseignantes sur ce seul travail
Statut de validationscore_only:v0-immature-baseline · tel quel depuis la passe de notation : score_only signifie que le nombre peut ordonner les travaux, et qu'aucune étiquette de catégorie n'en découle

Classification

machine, non validée

Prédiction automatique; un appel candidat d’une seule source (Gemma direct ou Codex distillé), pas un consensus.

Les modèles n’ont appliqué aucune catégorie : rien dans la taxonomie ne correspondait à ce travail.
Devis d'étudeÉtude de cas
Domainenon disponible
GenreEmpirique

Le détail, modèle par modèle et score par score, se trouve en fin de page sous « Comment cette classification a été obtenue ».

En bref

Citations4
Publié2020
Routes d'admission1
Résumé présentoui

Explorer davantage

Même revuePlant DiseaseMême sujetPlant Virus Research StudiesTravaux en français237 207