First Report of Grapevine Asteroid Mosaic Associated Virus in Grapevine in Spain
Bibliographic record
Abstract
Grapevine asteroid mosaic associated virus (GAMaV) is a member of the genus Marafivirus, family Tymoviridae. GAMaV was initially found to infect grapevine (Vitis vinifera) in California and was also reported in Japan, Canada, Uruguay, France, Hungary and Italy (Nakaune et al. 2008; Vargas-Asencio et al. 2017; Candresse et al. 2017; Porceddu et al. 2018). In July 2019 a grapevine sample from cv. Tempranillo (TS1), collected in a random survey from a vineyard in a Spanish grapevine growing area (D.O. Utiel-Requena), showing chlorotic mottling and leaf deformations, was analyzed by high throughput sequencing (HTS). Total RNA extracted from leaves was sequenced after ribo-depletion (Ribo-Zero Plant kit, Illumina) using TrueSeq Illumina technology (150 nt pair-end reads). Data analysis was performed by CLC Genomics Workbench 10.1.1. After quality control and host genome subtraction 2,410,654 reads were used for de novo assembly. BLAST analysis of the 13,303 contigs obtained revealed the presence of four contigs (2736, 1448, 1285 and 954 nt in size) related to GAMaV, indicating the presence of this virus in TS1 sample. Contigs related to other viruses/viroids were also found, in particular Grapevine rupestris stem pitting-associated virus, Grapevine leafroll-associated virus 3, Grapevine virus A, Grapevine fleck virus, Grapevine red globe virus, Grapevine rupestris vein feathering virus and Hop stunt viroid. For the assembly of the full-length GAMaV genome, contigs were extended by mapping the reads against the contigs using Geneious Prime 2020 software. This mapping step allowed the recovery of the GAMaV genomic sequence (635 reads, average coverage per nucleotide 10.0) with the exception of a small gap of 147 nt in the helicase region of the polyprotein. The gap in the genomic region was covered by RT-PCR using two newly designed primers overlapping the flanking regions (GAMaV-3755-F, 5'ATCCTCACCAACTCCC3' and GAMaV-3985-R, 5'GTTGGAAGTGGTGTG3'). Nearly complete sequence of the isolate TS1 (6,692 nt, MT459830) showed 87.7% nucleotide identity with the isolate 16GVP031 (MK253012) from France. The phylogenetic analysis performed on the available GAMaV full-length genomes showed that the Spanish isolate was positioned in a distinct clade (Supp. Fig. 1). The presence of GAMaV in Spain was further evaluated by reverse transcription-polymerase chain reaction (RT-PCR). Specific GAMaV primers, GAMaV-F3 and GAMaV-R3 previously reported by Candresse et al. (2017) were used without any success, due to primer mismatching. Based on TS1 sequence, two primers (GAMaV-6010F, 5'CCCTCCTCCTAGCGACGACC3' and GAMaV-6426R, 5'GGGTTGAGACGGCGGAGATC3') were designed and used to amplify a fragment of 417 nt in the CP region. Sanger sequencing of the obtained RT-PCR product confirmed the HTS recovered sequence. A total of 52 randomly collected samples from the same grapevine growing area were analyzed by RT-PCR using the newly designed primers. One sample bearing similar symptoms, TS7 (MT770919, cv. Tempranillo), and eight symptomless samples, MS1, MS2 and MS3 (MT770911, MT770917 and MT770918, cv. Macabeo), and TS2, TS3, TS4, TS5 and TS6 (MT770912, MT770913, MT770914, MT770915 and MT770916, cv. Tempranillo), tested positive for GAMaV, thus confirming its presence in Spanish vineyards. The nucleotide identity between these partial sequences and the homologous region of TS1 ranged from 94.7% to 98.8%, 0.04 being the mean diversity among isolates at the CP genomic region estimated by MEGA X software. To our knowledge, this is the first report of GAMaV in grapevine in Spain. The presence of other viruses/viroids in TS1 sample and the finding of asymptomatic GAMaV infected plants make difficult to associate this virus to the observed symptomatology. Other latent or semilatent GAMaV infections have been previously reported (Martelli 2014; Candresse et al. 2017).
Fetched live from OpenAlex and de-inverted. Abstracts are not stored in this database: the inverted indexes are 8.6 GB of the frame’s 9.3 GB of text, and the host has 13 GB free.
How this classification was reachedexpand
Full frame machine prediction
Teacher imitationNot calibrated prevalence, not ground truth. Human validation pending. The Gemma side is a direct model label for every work in the frame, read from the title-only record. The Codex side is a classifier learned from the 10,348 direct Codex labels and calibrated to design-weighted sample rates; fields without enough sample support carry no Codex call. Candidate is the union of the two sides; consensus is their intersection. These outputs are machine_predicted_unvalidated and are not human labels.
Distilled classifier scores by category (both heads)
| Category | Codex | Gemma |
|---|---|---|
| Metaresearch | 0.001 | 0.001 |
| Meta-epidemiology (narrow) | 0.001 | 0.000 |
| Meta-epidemiology (broad) | 0.001 | 0.001 |
| Bibliometrics | 0.002 | 0.001 |
| Science and technology studies | 0.001 | 0.000 |
| Scholarly communication | 0.003 | 0.000 |
| Open science | 0.001 | 0.001 |
| Research integrity | 0.001 | 0.001 |
| Insufficient payload (model declined to judge) | 0.001 | 0.001 |
Machine scores (provisional)
The two teacher heads of the student model, read on this work. A score orders the frame for review; it never asserts a category, and the validation status ships verbatim with every row.
Baseline scores from an immature model (maturity gate not passed, 7 training rounds). Scores rank; they never assert a category.
score_only:v0-immature-baseline · verbatim from the scoring run: score_only means the number may rank works, and no category label ships from itClassification
machine, unvalidatedMachine predicted; a candidate call from one source (direct Gemma or distilled Codex), not a consensus.
How this classification was reached, model by model and score by score, is at the end of the page under "How this classification was reached".