First Detection of Aster Yellows Associated with Phytoplasma on <i>Camelina sativa</i> in Montana
Notice bibliographique
Résumé
) infection. Symptoms included stunted growth, purpling of leaves, phyllody, proliferation of shoots and axillary shoots, and a reduced number or absence of pods (Figure 1). We examined 1696 single plants in a field experiment, approximately 4% in the 0.5-acre plot was found with symptoms. Plants were collected from seven locations across the field, with three replicate plants per location. Two 2-cm pieces of branches were taken from each plant for DNA extraction, using the BioSprint DNA Plant Kit (Qiagen, Germany) following the manufacturer's instructions. DNA was amplified by nested PCR first using the primers P1 (AAGAGTTTGATCCTGGCTCAGGATT) and P6 (TGGTAGGGATACCTTGTTACGACTTA), then R16F2 (ACGACTGCTGCTAAGACTGG) and R16R2 (TGACGGGCGGTGTGTACAAACCCCG), according to the protocol described by Olivier et al. (2010). These primers are universal for phytoplasma detection, which amplify a specific 16S rDNA fragment. PCR products of 1200 bp were obtained from all symptomatic plants, while no amplicons were obtained from the asymptomatic plants, including the asymptomatic parts of the partially infected plant. The PCR products were sequenced with primers R16F2 and R16R2 from both 5' and 3' ends, and the resulting sequences were submitted to GenBank (accession no. PQ134480). BLASTN search showed that the sequences we obtained were 99.46% similar to Maryland aster yellows phytoplasma (accession no. KC283215) and Sesame phyllody phytoplasma (accession no. JX448399, JX448400, JX448401, HM449958). To further confirm the identity of the pathogen, a second set of primers fTuf1 (CACATTGACCACGGTAAAAC) and rTuf1 (CCACCTTCACGAATAGAGAAC) were used (Schneider et al. 1997). These primers universally amplify phytoplasma elongation factor TU (tuf) gene fragment. PCR products around 1100 bp were obtained, sequenced with the same primers, and submitted to GenBank (accession no. PQ256823). BLASTN result shows that the sequences were 99.80% identical to aster yellows witches'-broom phytoplasma (accession no. AY277404, CP000061). These sequencing results suggest that the pathogen infecting camelina is aster yellows phytoplasma. Aster yellows has been reported on camelina in South Dakota (Byamukama et al. 2016) and Canada (Séguin-Swartz et al. 2009). Our sequence was 100% similar to the one reported in South Dakota. To our knowledge, this is the first report of aster yellows on camelina in Montana. The phytoplasma has a wide host range, primarily Asteraceae, and is vectored by the aster leafhopper (Macrosteles quadrilineatus). Weeds in the Asteraceae can act as reservoirs for the carryover of the pathogen from year to year. The pathogen can also infect canola, barley, wheat, peas, and alfalfa, which are widely grown as rotation crops in the Sidney, MT area. The aster leafhopper is commonly found on wheat in SD (Varenhorst, 2024). The distribution and impact of aster yellows on camelina productivity in Montana remains to be determined, but this discovery alerts the researchers and growers to be aware of the disease.
Récupéré en direct depuis OpenAlex et désinversé. Les résumés ne sont pas conservés dans cette base de données : les index inversés représentent 8,6 Go des 9,3 Go de texte de la base, et le serveur dispose de 13 Go libres.
Comment cette classification a été obtenuedéplier
Prédiction machine sur la base complète
Imitation des enseignantsNi prévalence calibrée, ni vérité terrain. Validation humaine à venir. Le volet Gemma est une étiquette directe du modèle pour chaque travail de la base, lue sur la notice réduite au titre. Le volet Codex est un classifieur appris des 10 348 étiquettes directes de Codex et calibré sur les taux pondérés de l'échantillon; les champs sans appui suffisant ne portent aucun appel Codex. Le mode candidate est l'union des deux volets; le consensus est leur intersection. Ces sorties portent le statut machine_predicted_unvalidated et ne sont pas des étiquettes humaines.
Scores du classifieur distillé par catégorie (deux têtes)
| Catégorie | Codex | Gemma |
|---|---|---|
| Métarecherche | 0,000 | 0,000 |
| Méta-épidémiologie (sens strict) | 0,000 | 0,000 |
| Méta-épidémiologie (sens large) | 0,000 | 0,000 |
| Bibliométrie | 0,000 | 0,000 |
| Études des sciences et des technologies | 0,000 | 0,000 |
| Communication savante | 0,000 | 0,000 |
| Science ouverte | 0,000 | 0,000 |
| Intégrité de la recherche | 0,000 | 0,000 |
| Charge utile insuffisante (le modèle a refusé de juger) | 0,001 | 0,001 |
Scores machine (provisoires)
Les deux têtes enseignantes du modèle étudiant, lues sur ce travail. Un score ordonne la base pour la relecture; il n'affirme jamais une catégorie, et le statut de validation accompagne chaque rangée tel quel.
Scores de référence d'un modèle non mature (critères de maturité non atteints, 7 itérations). Un score ordonne; il n'affirme jamais une catégorie.
score_only:v0-immature-baseline · tel quel depuis la passe de notation : score_only signifie que le nombre peut ordonner les travaux, et qu'aucune étiquette de catégorie n'en découleClassification
machine, non validéePrédiction automatique; un appel candidat d’une seule source (Gemma direct ou Codex distillé), pas un consensus.
Le détail, modèle par modèle et score par score, se trouve en fin de page sous « Comment cette classification a été obtenue ».