MétaCan
Menu
Retour à la cohorte
Enregistrement W4404787635 · doi:10.1094/pdis-09-24-1875-pdn

First Detection of Aster Yellows Associated with Phytoplasma on <i>Camelina sativa</i> in Montana

2024· article· en· W4404787635 sur OpenAlexaboutno aff
Nuan Wen, Chengci Chen, Kim Campbell, Chaofu Lu, Timothy C. Paulitz

Notice bibliographique

RevuePlant Disease · 2024
Typearticle
Langueen
DomaineAgricultural and Biological Sciences
ThématiquePlant pathogens and resistance mechanisms
Établissements canadiensnon disponible
Organismes subventionnairesnon disponible
Mots-clésPhytoplasmaBiologyAster yellowsCamelina sativaCamelinaPhyllodyLeafhopperCropHorticultureShootBotanyAgronomyPolymerase chain reactionRestriction fragment length polymorphism

Résumé

récupéré en direct d'OpenAlex

) infection. Symptoms included stunted growth, purpling of leaves, phyllody, proliferation of shoots and axillary shoots, and a reduced number or absence of pods (Figure 1). We examined 1696 single plants in a field experiment, approximately 4% in the 0.5-acre plot was found with symptoms. Plants were collected from seven locations across the field, with three replicate plants per location. Two 2-cm pieces of branches were taken from each plant for DNA extraction, using the BioSprint DNA Plant Kit (Qiagen, Germany) following the manufacturer's instructions. DNA was amplified by nested PCR first using the primers P1 (AAGAGTTTGATCCTGGCTCAGGATT) and P6 (TGGTAGGGATACCTTGTTACGACTTA), then R16F2 (ACGACTGCTGCTAAGACTGG) and R16R2 (TGACGGGCGGTGTGTACAAACCCCG), according to the protocol described by Olivier et al. (2010). These primers are universal for phytoplasma detection, which amplify a specific 16S rDNA fragment. PCR products of 1200 bp were obtained from all symptomatic plants, while no amplicons were obtained from the asymptomatic plants, including the asymptomatic parts of the partially infected plant. The PCR products were sequenced with primers R16F2 and R16R2 from both 5' and 3' ends, and the resulting sequences were submitted to GenBank (accession no. PQ134480). BLASTN search showed that the sequences we obtained were 99.46% similar to Maryland aster yellows phytoplasma (accession no. KC283215) and Sesame phyllody phytoplasma (accession no. JX448399, JX448400, JX448401, HM449958). To further confirm the identity of the pathogen, a second set of primers fTuf1 (CACATTGACCACGGTAAAAC) and rTuf1 (CCACCTTCACGAATAGAGAAC) were used (Schneider et al. 1997). These primers universally amplify phytoplasma elongation factor TU (tuf) gene fragment. PCR products around 1100 bp were obtained, sequenced with the same primers, and submitted to GenBank (accession no. PQ256823). BLASTN result shows that the sequences were 99.80% identical to aster yellows witches'-broom phytoplasma (accession no. AY277404, CP000061). These sequencing results suggest that the pathogen infecting camelina is aster yellows phytoplasma. Aster yellows has been reported on camelina in South Dakota (Byamukama et al. 2016) and Canada (Séguin-Swartz et al. 2009). Our sequence was 100% similar to the one reported in South Dakota. To our knowledge, this is the first report of aster yellows on camelina in Montana. The phytoplasma has a wide host range, primarily Asteraceae, and is vectored by the aster leafhopper (Macrosteles quadrilineatus). Weeds in the Asteraceae can act as reservoirs for the carryover of the pathogen from year to year. The pathogen can also infect canola, barley, wheat, peas, and alfalfa, which are widely grown as rotation crops in the Sidney, MT area. The aster leafhopper is commonly found on wheat in SD (Varenhorst, 2024). The distribution and impact of aster yellows on camelina productivity in Montana remains to be determined, but this discovery alerts the researchers and growers to be aware of the disease.

Récupéré en direct depuis OpenAlex et désinversé. Les résumés ne sont pas conservés dans cette base de données : les index inversés représentent 8,6 Go des 9,3 Go de texte de la base, et le serveur dispose de 13 Go libres.

Comment cette classification a été obtenuedéplier

Prédiction machine sur la base complète

Imitation des enseignants

Ni prévalence calibrée, ni vérité terrain. Validation humaine à venir. Le volet Gemma est une étiquette directe du modèle pour chaque travail de la base, lue sur la notice réduite au titre. Le volet Codex est un classifieur appris des 10 348 étiquettes directes de Codex et calibré sur les taux pondérés de l'échantillon; les champs sans appui suffisant ne portent aucun appel Codex. Le mode candidate est l'union des deux volets; le consensus est leur intersection. Ces sorties portent le statut machine_predicted_unvalidated et ne sont pas des étiquettes humaines.

score de la tête « metaresearch » (Codex)0,000
score de la tête « metaresearch » (Gemma)0,000
Version: metacan-v3-hybrid-931329e0061cStatut de validation: machine_predicted_unvalidated
Catégories candidatesaucune
Catégories consensuellesaucune
DomaineSignal candidat: aucune · Signal consensuel: aucune
Devis d'étudeSignal candidat: Observationnel · Signal consensuel: aucune
GenreSignal candidat: Empirique · Signal consensuel: Empirique
Score de désaccord entre enseignants0,002
Score d'incertitude au seuil0,004

Scores du classifieur distillé par catégorie (deux têtes)

CatégorieCodexGemma
Métarecherche0,0000,000
Méta-épidémiologie (sens strict)0,0000,000
Méta-épidémiologie (sens large)0,0000,000
Bibliométrie0,0000,000
Études des sciences et des technologies0,0000,000
Communication savante0,0000,000
Science ouverte0,0000,000
Intégrité de la recherche0,0000,000
Charge utile insuffisante (le modèle a refusé de juger)0,0010,001

Scores machine (provisoires)

Les deux têtes enseignantes du modèle étudiant, lues sur ce travail. Un score ordonne la base pour la relecture; il n'affirme jamais une catégorie, et le statut de validation accompagne chaque rangée tel quel.

Scores de référence d'un modèle non mature (critères de maturité non atteints, 7 itérations). Un score ordonne; il n'affirme jamais une catégorie.

Tête enseignante Opus0,010
Tête enseignante GPT0,173
Écart entre enseignants0,163 · la distance entre les deux têtes enseignantes sur ce seul travail
Statut de validationscore_only:v0-immature-baseline · tel quel depuis la passe de notation : score_only signifie que le nombre peut ordonner les travaux, et qu'aucune étiquette de catégorie n'en découle

Classification

machine, non validée

Prédiction automatique; un appel candidat d’une seule source (Gemma direct ou Codex distillé), pas un consensus.

Les modèles n’ont appliqué aucune catégorie : rien dans la taxonomie ne correspondait à ce travail.
Devis d'étudeObservationnel
Domainenon disponible
GenreEmpirique

Le détail, modèle par modèle et score par score, se trouve en fin de page sous « Comment cette classification a été obtenue ».

En bref

Citations1
Publié2024
Routes d'admission1
Résumé présentoui

Explorer davantage

Même revuePlant DiseaseMême sujetPlant pathogens and resistance mechanismsTravaux en français237 207