First Detection of Aster Yellows Associated with Phytoplasma on <i>Camelina sativa</i> in Montana

) infection. Symptoms included stunted growth, purpling of leaves, phyllody, proliferation of shoots and axillary shoots, and a reduced number or absence of pods (Figure 1). We examined 1696 single plants in a field experiment, approximately 4% in the 0.5-acre plot was found with symptoms. Plants were collected from seven locations across the field, with three replicate plants per location. Two 2-cm pieces of branches were taken from each plant for DNA extraction, using the BioSprint DNA Plant Kit (Qiagen, Germany) following the manufacturer's instructions. DNA was amplified by nested PCR first using the primers P1 (AAGAGTTTGATCCTGGCTCAGGATT) and P6 (TGGTAGGGATACCTTGTTACGACTTA), then R16F2 (ACGACTGCTGCTAAGACTGG) and R16R2 (TGACGGGCGGTGTGTACAAACCCCG), according to the protocol described by Olivier et al. (2010). These primers are universal for phytoplasma detection, which amplify a specific 16S rDNA fragment. PCR products of 1200 bp were obtained from all symptomatic plants, while no amplicons were obtained from the asymptomatic plants, including the asymptomatic parts of the partially infected plant. The PCR products were sequenced with primers R16F2 and R16R2 from both 5' and 3' ends, and the resulting sequences were submitted to GenBank (accession no. PQ134480). BLASTN search showed that the sequences we obtained were 99.46% similar to Maryland aster yellows phytoplasma (accession no. KC283215) and Sesame phyllody phytoplasma (accession no. JX448399, JX448400, JX448401, HM449958). To further confirm the identity of the pathogen, a second set of primers fTuf1 (CACATTGACCACGGTAAAAC) and rTuf1 (CCACCTTCACGAATAGAGAAC) were used (Schneider et al. 1997). These primers universally amplify phytoplasma elongation factor TU (tuf) gene fragment. PCR products around 1100 bp were obtained, sequenced with the same primers, and submitted to GenBank (accession no. PQ256823). BLASTN result shows that the sequences were 99.80% identical to aster yellows witches'-broom phytoplasma (accession no. AY277404, CP000061). These sequencing results suggest that the pathogen infecting camelina is aster yellows phytoplasma. Aster yellows has been reported on camelina in South Dakota (Byamukama et al. 2016) and Canada (Séguin-Swartz et al. 2009). Our sequence was 100% similar to the one reported in South Dakota. To our knowledge, this is the first report of aster yellows on camelina in Montana. The phytoplasma has a wide host range, primarily Asteraceae, and is vectored by the aster leafhopper (Macrosteles quadrilineatus). Weeds in the Asteraceae can act as reservoirs for the carryover of the pathogen from year to year. The pathogen can also infect canola, barley, wheat, peas, and alfalfa, which are widely grown as rotation crops in the Sidney, MT area. The aster leafhopper is commonly found on wheat in SD (Varenhorst, 2024). The distribution and impact of aster yellows on camelina productivity in Montana remains to be determined, but this discovery alerts the researchers and growers to be aware of the disease.

Fetched live from OpenAlex and de-inverted. Abstracts are not stored in this database: the inverted indexes are 8.6 GB of the frame’s 9.3 GB of text, and the host has 13 GB free.