First Report of ‘ <i>Candidatus</i> Phytoplasma asteris’ Infecting Okra in the United States
Notice bibliographique
Résumé
Okra (Abelmoschus esculentus) was cultivated on 1,342 hectares in the United States in 2023, producing 10,540 tonnes (FAOSTAT). During a field survey conducted in 2023, a single okra plant in a plot (roughly 0.1 acre) cultivated in Tulsa County, Oklahoma, displayed symptoms of virescence, phyllody, and witches’-broom. Leaf tissues were collected from one symptomatic (sample K7) and three asymptomatic plants. Total RNA and genomic DNA were extracted using the Plant RNA Isolation Kit (Norgen Biotek Corp, Ontario, Canada) and Plant DNA Kit (Omega BIO-TEK). RNA from the samples was subjected to high-throughput sequencing (HTS) on the NovaSeq X Plus at the Oklahoma Medical Research Foundation. After trimming, 16,454,026 reads (average length = 151 bp) were de novo assembled using CLC Genomics Workbench v22.0.1 (QIAGEN) and analysed via BLASTn and BLASTx analyses against the NCBI GenBank (nr) database. Thirty-six contigs (205-664 bp) showed similarity to the ‘Candidatus Phytoplasma 16SrI group with an average coverage ranging from 1.6 to 118.1X. Later in the season, disease progression was observed on the same plant (K7), and additional symptomatic leaf tissues were collected and processed as described above. The second HTS run yielded 53,701,463 reads (average length = 130 bp). De novo assembly produced 617 contigs (190-15,179 bp), matching ‘Candidatus Phytoplasma asteris’ (rapeseed phyllody phytoplasma, CP055264) with coverage ranging from 2.04 to 23,516.25X. Raw sequencing reads were deposited in the NCBI database under the Sequence Read Archive (SRA) SRR32988524. To confirm the HTS results, PCR was performed using DNA from the K7 sample and healthy okra plants, with two primer sets designed from HTS-derived contigs (1F CTCATCCTGTAAGCGTTGCC, 1R AGCGGCTTTGATGTTGGATC (446 bp), and 2F CCAAACCGCAGTGCTAACAT, 2R GTTTTGACCCCACGAGCTTT (product size 524-bp). Both expected amplicons (446 and 524 bp, respectively) were detected in the symptomatic sample (K7) but none in the asymptomatic sample. Sanger sequencing and BLASTn of the PCR products confirmed 99.03% and 99.8% nucleotide identity to the rapeseed phyllody phytoplasma isolate RP166 (GenBank accession CP055264). Additionally, the full-length 16S rRNA gene (1,521 bp) retrieved from HTS data revealed 99.8% identity with the same isolate. Based on the iPhyClassifier analysis (Wei et al. 2007; Zhao et al. 2009), the phytoplasma strain was classified as ‘Candidatus Phytoplasma asteris’ subgroup 16Srl-B. ‘Candidatus Phytoplasma asteris’ has been previously associated with phyllody in oilseed rape in Poland (Zwolińska et al. 2011), rapeseed phyllody disease (Cho et al. 2020), little leaf disease of cotton and luffa in India (Kumar et al. 2010), tomato stunt in Cuba (Zamora et al. 2014) and other crop diseases. This study presents the first confirmed report of rapeseed phyllody phytoplasma infecting okra in Oklahoma, and United States. Okra is a significant cash crop for both small and large-scale farmers and widely cultivated vegetable in Oklahoma and various other states across the United States. It has numerous nutritional benefits (vitamins, minerals, dietary fibre and antioxidants) in the human diet and traditional medicine. Okra is susceptible to various diseases. Therefore, conducting a comprehensive survey of okra fields is crucial to identify potential disease threats and to implement effective measures for the protection and sustainability of this important crop.
Récupéré en direct depuis OpenAlex et désinversé. Les résumés ne sont pas conservés dans cette base de données : les index inversés représentent 8,6 Go des 9,3 Go de texte de la base, et le serveur dispose de 13 Go libres.
Comment cette classification a été obtenuedéplier
Prédiction machine sur la base complète
Imitation des enseignantsNi prévalence calibrée, ni vérité terrain. Validation humaine à venir. Le volet Gemma est une étiquette directe du modèle pour chaque travail de la base, lue sur la notice réduite au titre. Le volet Codex est un classifieur appris des 10 348 étiquettes directes de Codex et calibré sur les taux pondérés de l'échantillon; les champs sans appui suffisant ne portent aucun appel Codex. Le mode candidate est l'union des deux volets; le consensus est leur intersection. Ces sorties portent le statut machine_predicted_unvalidated et ne sont pas des étiquettes humaines.
Scores du classifieur distillé par catégorie (deux têtes)
| Catégorie | Codex | Gemma |
|---|---|---|
| Métarecherche | 0,000 | 0,000 |
| Méta-épidémiologie (sens strict) | 0,000 | 0,000 |
| Méta-épidémiologie (sens large) | 0,000 | 0,000 |
| Bibliométrie | 0,001 | 0,000 |
| Études des sciences et des technologies | 0,002 | 0,000 |
| Communication savante | 0,001 | 0,000 |
| Science ouverte | 0,000 | 0,000 |
| Intégrité de la recherche | 0,001 | 0,000 |
| Charge utile insuffisante (le modèle a refusé de juger) | 0,001 | 0,000 |
Scores machine (provisoires)
Les deux têtes enseignantes du modèle étudiant, lues sur ce travail. Un score ordonne la base pour la relecture; il n'affirme jamais une catégorie, et le statut de validation accompagne chaque rangée tel quel.
Scores de référence d'un modèle non mature (critères de maturité non atteints, 7 itérations). Un score ordonne; il n'affirme jamais une catégorie.
score_only:v0-immature-baseline · tel quel depuis la passe de notation : score_only signifie que le nombre peut ordonner les travaux, et qu'aucune étiquette de catégorie n'en découleClassification
machine, non validéePrédiction automatique; un appel candidat d’une seule source (Gemma direct ou Codex distillé), pas un consensus.
Le détail, modèle par modèle et score par score, se trouve en fin de page sous « Comment cette classification a été obtenue ».