MétaCan
Menu
Back to cohort
Record W4414260843 · doi:10.1094/pdis-06-25-1247-pdn

First Report of ‘ <i>Candidatus</i> Phytoplasma asteris’ Infecting Okra in the United States

2025· article· en· W4414260843 on OpenAlexaboutno aff
Salil Jindal, Akhtar Ali

Bibliographic record

VenuePlant Disease · 2025
Typearticle
Languageen
FieldAgricultural and Biological Sciences
TopicPhytoplasmas and Hemiptera pathogens
Canadian institutionsnot available
FundersUniversity of Tulsa
KeywordsPhytoplasmaContigGenBankRNA extractionDNA sequencingSequence assemblyBroomgenomic DNAReference genome

Abstract

fetched live from OpenAlex

Okra (Abelmoschus esculentus) was cultivated on 1,342 hectares in the United States in 2023, producing 10,540 tonnes (FAOSTAT). During a field survey conducted in 2023, a single okra plant in a plot (roughly 0.1 acre) cultivated in Tulsa County, Oklahoma, displayed symptoms of virescence, phyllody, and witches’-broom. Leaf tissues were collected from one symptomatic (sample K7) and three asymptomatic plants. Total RNA and genomic DNA were extracted using the Plant RNA Isolation Kit (Norgen Biotek Corp, Ontario, Canada) and Plant DNA Kit (Omega BIO-TEK). RNA from the samples was subjected to high-throughput sequencing (HTS) on the NovaSeq X Plus at the Oklahoma Medical Research Foundation. After trimming, 16,454,026 reads (average length = 151 bp) were de novo assembled using CLC Genomics Workbench v22.0.1 (QIAGEN) and analysed via BLASTn and BLASTx analyses against the NCBI GenBank (nr) database. Thirty-six contigs (205-664 bp) showed similarity to the ‘Candidatus Phytoplasma 16SrI group with an average coverage ranging from 1.6 to 118.1X. Later in the season, disease progression was observed on the same plant (K7), and additional symptomatic leaf tissues were collected and processed as described above. The second HTS run yielded 53,701,463 reads (average length = 130 bp). De novo assembly produced 617 contigs (190-15,179 bp), matching ‘Candidatus Phytoplasma asteris’ (rapeseed phyllody phytoplasma, CP055264) with coverage ranging from 2.04 to 23,516.25X. Raw sequencing reads were deposited in the NCBI database under the Sequence Read Archive (SRA) SRR32988524. To confirm the HTS results, PCR was performed using DNA from the K7 sample and healthy okra plants, with two primer sets designed from HTS-derived contigs (1F CTCATCCTGTAAGCGTTGCC, 1R AGCGGCTTTGATGTTGGATC (446 bp), and 2F CCAAACCGCAGTGCTAACAT, 2R GTTTTGACCCCACGAGCTTT (product size 524-bp). Both expected amplicons (446 and 524 bp, respectively) were detected in the symptomatic sample (K7) but none in the asymptomatic sample. Sanger sequencing and BLASTn of the PCR products confirmed 99.03% and 99.8% nucleotide identity to the rapeseed phyllody phytoplasma isolate RP166 (GenBank accession CP055264). Additionally, the full-length 16S rRNA gene (1,521 bp) retrieved from HTS data revealed 99.8% identity with the same isolate. Based on the iPhyClassifier analysis (Wei et al. 2007; Zhao et al. 2009), the phytoplasma strain was classified as ‘Candidatus Phytoplasma asteris’ subgroup 16Srl-B. ‘Candidatus Phytoplasma asteris’ has been previously associated with phyllody in oilseed rape in Poland (Zwolińska et al. 2011), rapeseed phyllody disease (Cho et al. 2020), little leaf disease of cotton and luffa in India (Kumar et al. 2010), tomato stunt in Cuba (Zamora et al. 2014) and other crop diseases. This study presents the first confirmed report of rapeseed phyllody phytoplasma infecting okra in Oklahoma, and United States. Okra is a significant cash crop for both small and large-scale farmers and widely cultivated vegetable in Oklahoma and various other states across the United States. It has numerous nutritional benefits (vitamins, minerals, dietary fibre and antioxidants) in the human diet and traditional medicine. Okra is susceptible to various diseases. Therefore, conducting a comprehensive survey of okra fields is crucial to identify potential disease threats and to implement effective measures for the protection and sustainability of this important crop.

Fetched live from OpenAlex and de-inverted. Abstracts are not stored in this database: the inverted indexes are 8.6 GB of the frame’s 9.3 GB of text, and the host has 13 GB free.

How this classification was reachedexpand

Full frame distilled prediction

Teacher imitation

Not calibrated prevalence, not ground truth. Human validation pending. Learned from the 10,348 direct Codex labels and 10,348 direct Gemma labels. Candidate is the union of thresholded teacher heads; consensus is their intersection. These outputs are machine_predicted_unvalidated and are not human labels or direct frontier model labels.

metaresearch head score (Codex)0.000
metaresearch head score (Gemma)0.000
Version: codex-gemma-dda1882f352aValidation status: machine_predicted_unvalidated
Candidate categoriesnone
Consensus categoriesnone
DomainCandidate signal: none · Consensus signal: none
Study designCandidate signal: Observational · Consensus signal: Observational
GenreCandidate signal: Empirical · Consensus signal: Empirical
Teacher disagreement score0.101
Threshold uncertainty score0.135

Codex and Gemma teacher scores by category

CategoryCodexGemma
Metaresearch0.0000.000
Meta-epidemiology (narrow)0.0000.000
Meta-epidemiology (broad)0.0000.000
Bibliometrics0.0000.000
Science and technology studies0.0000.000
Scholarly communication0.0000.000
Open science0.0000.000
Research integrity0.0000.000
Insufficient payload (model declined to judge)0.0000.000

Machine scores (provisional)

The two teacher heads of the student model, read on this work. A score orders the frame for review; it never asserts a category, and the validation status ships verbatim with every row.

Baseline scores from an immature model (maturity gate not passed, 7 training rounds). Scores rank; they never assert a category.

Opus teacher head0.013
GPT teacher head0.220
Teacher spread0.207 · how far apart the two teachers sit on this one work
Validation statusscore_only:v0-immature-baseline · verbatim from the scoring run: score_only means the number may rank works, and no category label ships from it

Classification

machine, unvalidated

Machine predicted; a candidate call from one teacher head, not a consensus.

The models applied no category: nothing in the taxonomy fit this work.
Study designObservational
Domainnot available
GenreEmpirical

How this classification was reached, model by model and score by score, is at the end of the page under "How this classification was reached".

Quick stats

Citations0
Published2025
Admission routes1
Has abstractyes

Explore more

Same venuePlant DiseaseSame topicPhytoplasmas and Hemiptera pathogensFrench-language works237,207