Cubus gracewoodae Zuniga, Valerio & Hanson 2025, sp. nov.
Notice bibliographique
Résumé
Cubus gracewoodae Zúñiga, Valerio & Hanson, sp. nov. (Figs. 4, 15, 20) Diagnostic description. Female. Fore wing length 6.8–7.6 mm. Malar space about 0.6 × basal mandibular width; combined face and clypeus (from clypeal apex to level of antennal sockets) about 1.6 × as high as wide (shortest distance between the eyes); posterior ocellus separated from eye by 0.6 × its own maximum diameter; antenna with 29–30 flagellomeres. Posterior projections of ventral mesothorax flattened and sharply pointed. Coloration. Black mark on occiput reaching laterally well beyond inner eye margin, with dorsal margin of black mark diverging from eye margin; lower 0.6 of pronotum black; ventral mesothorax completely yellow; hind coxa with black mark on both internal and external surfaces; propodeum with a longitudinal black mark that is chalice-shaped (narrower near the middle); tergite I with median black line reaching middle of tergite, with posterior portion greatly expanded laterally. Male. Similar to female. Comments. Cubus gracewoodae is one of three species that has the dorsal margin of black mark on the occiput diverging from eye margin (Table 1). It can be distinguished from these other two species by the size of the black mark on the lateral pronotum and the form of the black mark on the propodeum. Hosts. This species was found in the San Cristobal, Oro, and Brasilia Sectors. It has been reared on 23 occasions from Pantographa suffusalis and Pantographa Solis 116 (Crambidae) feeding on Allosidastrum pyramidatum, Hampea appendiculata, Wissadula excelsior (Malvaceae). Etymology. This species is named in honor of Grace Wood of the Canadian National Collection of Insects, in recognition of her contributions to the ACG tachinid fly inventory. Material. Holotype. ♀. Deposited at EMUS. Specimen labels: 1. DHJPAR0014030. 2. Caterpillar Voucher: D. H. Janzen & W. Hallwachs, DB: http://Janzen.sas.upenn.edu, Area de Conservation Guanacaste, Costa Rica, 04-SRNP-24207. Database information: Costa Rica, ACG, Guanacaste Prov., Sector Del Oro, Quebrada Raiz, 11.02865, -85.48669, 280m. (Lucia Rios) caterpillar feeding on Allosidastrum pyramidatum (Malvaceae) coll.21.xiii.2004 wasp eclosed 16.xi.2004. Paratypes. 20 ♀, 2 ♂, (EMUS, MNCR, MZUCR, USNM). COSTA RICA, ACG database codes: 04-SRNP-24259: DHJPAR0014026 (♀); 04-SRNP-24261: DHJPAR0014027 (♂); 04-SRNP-24792: DHJPAR0014034 (♀); 04-SRNP-26119: DHJPAR0014053 (♀); 04-SRNP-26120: DHJPAR0014031 (♀); 04-SRNP-26125: DHJPAR0014033 (♀); 04-SRNP-26132: DHJPAR0014049 (♀); 04-SRNP-26135: DHJPAR0014042 (♀); 04-SRNP-26387: DHJPAR0014046 (♀); 04-SRNP-26394: DHJPAR0014047 (♀); 04- SRNP-26471: DHJPAR0014038 (♀); 04-SRNP-26540: DHJPAR0014051 (♀); 04-SRNP-26541: DHJPAR0014041 (♀); 04-SRNP-26547: DHJPAR0014054 (♀); 04-SRNP-26549: DHJPAR0014050 (♀); 04-SRNP-26550: DHJPAR0014048 (♀); 04-SRNP-26552: DHJPAR0014055 (♀); 05-SRNP-7853: DHJPAR0009753 (♀); 09-SRNP-23374: DHJPAR0038419 (♂); 05-SRNP-33461: DHJPAR0028562 (♀); 07-SRNP-65964: DHJPAR0023305 (♀); 13-SRNP-540: DHJPAR0051744 (♀). Barcode. DNA barcode of female holotype DHJPAR0014030 (660 bp): ATATTATATTTTATTTTAGGAATCTGATCAGGTACAATTGGAACTTCTACAAGTATAATTATTCGAATTCAACTTA TAAATCCAATAAAACCATTAATTATTAATGATCAAATATATAATTCTTTAGTAACAATACATGCATTCTTAATAAT TTTTTTTTTAGTTATACCTACAATAATTGGAGGTTTCGGAAATTGATTAATTCCATTAATACTAGGAACTCCTGAT ATAGCATTCCCTCGAATAAATAATATAAGATTCTGACTTTTACCCCCCTCAATAATCATATTATTAATAAGAAGAA TTATTAATCAAGGACCAGGTACTGGGTGAACTATTTACCCCCCATTATCATCAAATATTAGACATGAAGGAATATC AGTTGATTATGCTATTTTCTCCCTACATATTGCGGGATCCTCATCTATTATAGGAGCAATTAATTTTATCACAACA ATTTTTAATTTAAAAATTAAAAATTTAAAAATAAGACAATTAACTCTTTTCTCATGATCAATTATTATTACATCAA TTTTACTTCTTTTAGCTGTTCCTGTTTTAGCTGGTGCTCTAACAATATTAATTTTTGATCGAAATTTAAATACATC ATTCTTTGACCCCTCAGGAGGGGGAGACCCAATTCTTTTCCAACATCTATTC
Récupéré en direct depuis OpenAlex et désinversé. Les résumés ne sont pas conservés dans cette base de données : les index inversés représentent 8,6 Go des 9,3 Go de texte de la base, et le serveur dispose de 13 Go libres.
Comment cette classification a été obtenuedéplier
Prédiction machine sur la base complète
Imitation des enseignantsNi prévalence calibrée, ni vérité terrain. Validation humaine à venir. Le volet Gemma est une étiquette directe du modèle pour chaque travail de la base, lue sur la notice réduite au titre. Le volet Codex est un classifieur appris des 10 348 étiquettes directes de Codex et calibré sur les taux pondérés de l'échantillon; les champs sans appui suffisant ne portent aucun appel Codex. Le mode candidate est l'union des deux volets; le consensus est leur intersection. Ces sorties portent le statut machine_predicted_unvalidated et ne sont pas des étiquettes humaines.
Scores du classifieur distillé par catégorie (deux têtes)
| Catégorie | Codex | Gemma |
|---|---|---|
| Métarecherche | 0,000 | 0,001 |
| Méta-épidémiologie (sens strict) | 0,001 | 0,000 |
| Méta-épidémiologie (sens large) | 0,000 | 0,000 |
| Bibliométrie | 0,001 | 0,001 |
| Études des sciences et des technologies | 0,001 | 0,001 |
| Communication savante | 0,001 | 0,001 |
| Science ouverte | 0,001 | 0,001 |
| Intégrité de la recherche | 0,001 | 0,001 |
| Charge utile insuffisante (le modèle a refusé de juger) | 0,006 | 0,003 |
Scores machine (provisoires)
Les deux têtes enseignantes du modèle étudiant, lues sur ce travail. Un score ordonne la base pour la relecture; il n'affirme jamais une catégorie, et le statut de validation accompagne chaque rangée tel quel.
Scores de référence d'un modèle non mature (critères de maturité non atteints, 7 itérations). Un score ordonne; il n'affirme jamais une catégorie.
score_only:v0-immature-baseline · tel quel depuis la passe de notation : score_only signifie que le nombre peut ordonner les travaux, et qu'aucune étiquette de catégorie n'en découleClassification
machine, non validéePrédiction automatique; un appel candidat d’une seule source (Gemma direct ou Codex distillé), pas un consensus.
Le détail, modèle par modèle et score par score, se trouve en fin de page sous « Comment cette classification a été obtenue ».