Cubus gracewoodae Zuniga, Valerio & Hanson 2025, sp. nov.
Bibliographic record
Abstract
Cubus gracewoodae Zúñiga, Valerio & Hanson, sp. nov. (Figs. 4, 15, 20) Diagnostic description. Female. Fore wing length 6.8–7.6 mm. Malar space about 0.6 × basal mandibular width; combined face and clypeus (from clypeal apex to level of antennal sockets) about 1.6 × as high as wide (shortest distance between the eyes); posterior ocellus separated from eye by 0.6 × its own maximum diameter; antenna with 29–30 flagellomeres. Posterior projections of ventral mesothorax flattened and sharply pointed. Coloration. Black mark on occiput reaching laterally well beyond inner eye margin, with dorsal margin of black mark diverging from eye margin; lower 0.6 of pronotum black; ventral mesothorax completely yellow; hind coxa with black mark on both internal and external surfaces; propodeum with a longitudinal black mark that is chalice-shaped (narrower near the middle); tergite I with median black line reaching middle of tergite, with posterior portion greatly expanded laterally. Male. Similar to female. Comments. Cubus gracewoodae is one of three species that has the dorsal margin of black mark on the occiput diverging from eye margin (Table 1). It can be distinguished from these other two species by the size of the black mark on the lateral pronotum and the form of the black mark on the propodeum. Hosts. This species was found in the San Cristobal, Oro, and Brasilia Sectors. It has been reared on 23 occasions from Pantographa suffusalis and Pantographa Solis 116 (Crambidae) feeding on Allosidastrum pyramidatum, Hampea appendiculata, Wissadula excelsior (Malvaceae). Etymology. This species is named in honor of Grace Wood of the Canadian National Collection of Insects, in recognition of her contributions to the ACG tachinid fly inventory. Material. Holotype. ♀. Deposited at EMUS. Specimen labels: 1. DHJPAR0014030. 2. Caterpillar Voucher: D. H. Janzen & W. Hallwachs, DB: http://Janzen.sas.upenn.edu, Area de Conservation Guanacaste, Costa Rica, 04-SRNP-24207. Database information: Costa Rica, ACG, Guanacaste Prov., Sector Del Oro, Quebrada Raiz, 11.02865, -85.48669, 280m. (Lucia Rios) caterpillar feeding on Allosidastrum pyramidatum (Malvaceae) coll.21.xiii.2004 wasp eclosed 16.xi.2004. Paratypes. 20 ♀, 2 ♂, (EMUS, MNCR, MZUCR, USNM). COSTA RICA, ACG database codes: 04-SRNP-24259: DHJPAR0014026 (♀); 04-SRNP-24261: DHJPAR0014027 (♂); 04-SRNP-24792: DHJPAR0014034 (♀); 04-SRNP-26119: DHJPAR0014053 (♀); 04-SRNP-26120: DHJPAR0014031 (♀); 04-SRNP-26125: DHJPAR0014033 (♀); 04-SRNP-26132: DHJPAR0014049 (♀); 04-SRNP-26135: DHJPAR0014042 (♀); 04-SRNP-26387: DHJPAR0014046 (♀); 04-SRNP-26394: DHJPAR0014047 (♀); 04- SRNP-26471: DHJPAR0014038 (♀); 04-SRNP-26540: DHJPAR0014051 (♀); 04-SRNP-26541: DHJPAR0014041 (♀); 04-SRNP-26547: DHJPAR0014054 (♀); 04-SRNP-26549: DHJPAR0014050 (♀); 04-SRNP-26550: DHJPAR0014048 (♀); 04-SRNP-26552: DHJPAR0014055 (♀); 05-SRNP-7853: DHJPAR0009753 (♀); 09-SRNP-23374: DHJPAR0038419 (♂); 05-SRNP-33461: DHJPAR0028562 (♀); 07-SRNP-65964: DHJPAR0023305 (♀); 13-SRNP-540: DHJPAR0051744 (♀). Barcode. DNA barcode of female holotype DHJPAR0014030 (660 bp): ATATTATATTTTATTTTAGGAATCTGATCAGGTACAATTGGAACTTCTACAAGTATAATTATTCGAATTCAACTTA TAAATCCAATAAAACCATTAATTATTAATGATCAAATATATAATTCTTTAGTAACAATACATGCATTCTTAATAAT TTTTTTTTTAGTTATACCTACAATAATTGGAGGTTTCGGAAATTGATTAATTCCATTAATACTAGGAACTCCTGAT ATAGCATTCCCTCGAATAAATAATATAAGATTCTGACTTTTACCCCCCTCAATAATCATATTATTAATAAGAAGAA TTATTAATCAAGGACCAGGTACTGGGTGAACTATTTACCCCCCATTATCATCAAATATTAGACATGAAGGAATATC AGTTGATTATGCTATTTTCTCCCTACATATTGCGGGATCCTCATCTATTATAGGAGCAATTAATTTTATCACAACA ATTTTTAATTTAAAAATTAAAAATTTAAAAATAAGACAATTAACTCTTTTCTCATGATCAATTATTATTACATCAA TTTTACTTCTTTTAGCTGTTCCTGTTTTAGCTGGTGCTCTAACAATATTAATTTTTGATCGAAATTTAAATACATC ATTCTTTGACCCCTCAGGAGGGGGAGACCCAATTCTTTTCCAACATCTATTC
Fetched live from OpenAlex and de-inverted. Abstracts are not stored in this database: the inverted indexes are 8.6 GB of the frame’s 9.3 GB of text, and the host has 13 GB free.
How this classification was reachedexpand
Full frame machine prediction
Teacher imitationNot calibrated prevalence, not ground truth. Human validation pending. The Gemma side is a direct model label for every work in the frame, read from the title-only record. The Codex side is a classifier learned from the 10,348 direct Codex labels and calibrated to design-weighted sample rates; fields without enough sample support carry no Codex call. Candidate is the union of the two sides; consensus is their intersection. These outputs are machine_predicted_unvalidated and are not human labels.
Distilled classifier scores by category (both heads)
| Category | Codex | Gemma |
|---|---|---|
| Metaresearch | 0.000 | 0.001 |
| Meta-epidemiology (narrow) | 0.001 | 0.000 |
| Meta-epidemiology (broad) | 0.000 | 0.000 |
| Bibliometrics | 0.001 | 0.001 |
| Science and technology studies | 0.001 | 0.001 |
| Scholarly communication | 0.001 | 0.001 |
| Open science | 0.001 | 0.001 |
| Research integrity | 0.001 | 0.001 |
| Insufficient payload (model declined to judge) | 0.006 | 0.003 |
Machine scores (provisional)
The two teacher heads of the student model, read on this work. A score orders the frame for review; it never asserts a category, and the validation status ships verbatim with every row.
Baseline scores from an immature model (maturity gate not passed, 7 training rounds). Scores rank; they never assert a category.
score_only:v0-immature-baseline · verbatim from the scoring run: score_only means the number may rank works, and no category label ships from itClassification
machine, unvalidatedMachine predicted; a candidate call from one source (direct Gemma or distilled Codex), not a consensus.
How this classification was reached, model by model and score by score, is at the end of the page under "How this classification was reached".