MétaCan
Menu
Back to cohort
Record W6911921982 · doi:10.5281/zenodo.14962238

Cubus gracewoodae Zuniga, Valerio & Hanson 2025, sp. nov.

2025· article· en· W6911921982 on OpenAlexaboutno aff

Bibliographic record

VenueZenodo (CERN European Organization for Nuclear Research) · 2025
Typearticle
Languageen
FieldAgricultural and Biological Sciences
TopicDiptera species taxonomy and behavior
Canadian institutionsnot available
Fundersnot available
KeywordsDorsumApex (geometry)OcciputSternumMedian plane

Abstract

fetched live from OpenAlex

Cubus gracewoodae Zúñiga, Valerio & Hanson, sp. nov. (Figs. 4, 15, 20) Diagnostic description. Female. Fore wing length 6.8–7.6 mm. Malar space about 0.6 × basal mandibular width; combined face and clypeus (from clypeal apex to level of antennal sockets) about 1.6 × as high as wide (shortest distance between the eyes); posterior ocellus separated from eye by 0.6 × its own maximum diameter; antenna with 29–30 flagellomeres. Posterior projections of ventral mesothorax flattened and sharply pointed. Coloration. Black mark on occiput reaching laterally well beyond inner eye margin, with dorsal margin of black mark diverging from eye margin; lower 0.6 of pronotum black; ventral mesothorax completely yellow; hind coxa with black mark on both internal and external surfaces; propodeum with a longitudinal black mark that is chalice-shaped (narrower near the middle); tergite I with median black line reaching middle of tergite, with posterior portion greatly expanded laterally. Male. Similar to female. Comments. Cubus gracewoodae is one of three species that has the dorsal margin of black mark on the occiput diverging from eye margin (Table 1). It can be distinguished from these other two species by the size of the black mark on the lateral pronotum and the form of the black mark on the propodeum. Hosts. This species was found in the San Cristobal, Oro, and Brasilia Sectors. It has been reared on 23 occasions from Pantographa suffusalis and Pantographa Solis 116 (Crambidae) feeding on Allosidastrum pyramidatum, Hampea appendiculata, Wissadula excelsior (Malvaceae). Etymology. This species is named in honor of Grace Wood of the Canadian National Collection of Insects, in recognition of her contributions to the ACG tachinid fly inventory. Material. Holotype. ♀. Deposited at EMUS. Specimen labels: 1. DHJPAR0014030. 2. Caterpillar Voucher: D. H. Janzen & W. Hallwachs, DB: http://Janzen.sas.upenn.edu, Area de Conservation Guanacaste, Costa Rica, 04-SRNP-24207. Database information: Costa Rica, ACG, Guanacaste Prov., Sector Del Oro, Quebrada Raiz, 11.02865, -85.48669, 280m. (Lucia Rios) caterpillar feeding on Allosidastrum pyramidatum (Malvaceae) coll.21.xiii.2004 wasp eclosed 16.xi.2004. Paratypes. 20 ♀, 2 ♂, (EMUS, MNCR, MZUCR, USNM). COSTA RICA, ACG database codes: 04-SRNP-24259: DHJPAR0014026 (♀); 04-SRNP-24261: DHJPAR0014027 (♂); 04-SRNP-24792: DHJPAR0014034 (♀); 04-SRNP-26119: DHJPAR0014053 (♀); 04-SRNP-26120: DHJPAR0014031 (♀); 04-SRNP-26125: DHJPAR0014033 (♀); 04-SRNP-26132: DHJPAR0014049 (♀); 04-SRNP-26135: DHJPAR0014042 (♀); 04-SRNP-26387: DHJPAR0014046 (♀); 04-SRNP-26394: DHJPAR0014047 (♀); 04- SRNP-26471: DHJPAR0014038 (♀); 04-SRNP-26540: DHJPAR0014051 (♀); 04-SRNP-26541: DHJPAR0014041 (♀); 04-SRNP-26547: DHJPAR0014054 (♀); 04-SRNP-26549: DHJPAR0014050 (♀); 04-SRNP-26550: DHJPAR0014048 (♀); 04-SRNP-26552: DHJPAR0014055 (♀); 05-SRNP-7853: DHJPAR0009753 (♀); 09-SRNP-23374: DHJPAR0038419 (♂); 05-SRNP-33461: DHJPAR0028562 (♀); 07-SRNP-65964: DHJPAR0023305 (♀); 13-SRNP-540: DHJPAR0051744 (♀). Barcode. DNA barcode of female holotype DHJPAR0014030 (660 bp): ATATTATATTTTATTTTAGGAATCTGATCAGGTACAATTGGAACTTCTACAAGTATAATTATTCGAATTCAACTTA TAAATCCAATAAAACCATTAATTATTAATGATCAAATATATAATTCTTTAGTAACAATACATGCATTCTTAATAAT TTTTTTTTTAGTTATACCTACAATAATTGGAGGTTTCGGAAATTGATTAATTCCATTAATACTAGGAACTCCTGAT ATAGCATTCCCTCGAATAAATAATATAAGATTCTGACTTTTACCCCCCTCAATAATCATATTATTAATAAGAAGAA TTATTAATCAAGGACCAGGTACTGGGTGAACTATTTACCCCCCATTATCATCAAATATTAGACATGAAGGAATATC AGTTGATTATGCTATTTTCTCCCTACATATTGCGGGATCCTCATCTATTATAGGAGCAATTAATTTTATCACAACA ATTTTTAATTTAAAAATTAAAAATTTAAAAATAAGACAATTAACTCTTTTCTCATGATCAATTATTATTACATCAA TTTTACTTCTTTTAGCTGTTCCTGTTTTAGCTGGTGCTCTAACAATATTAATTTTTGATCGAAATTTAAATACATC ATTCTTTGACCCCTCAGGAGGGGGAGACCCAATTCTTTTCCAACATCTATTC

Fetched live from OpenAlex and de-inverted. Abstracts are not stored in this database: the inverted indexes are 8.6 GB of the frame’s 9.3 GB of text, and the host has 13 GB free.

How this classification was reachedexpand

Full frame machine prediction

Teacher imitation

Not calibrated prevalence, not ground truth. Human validation pending. The Gemma side is a direct model label for every work in the frame, read from the title-only record. The Codex side is a classifier learned from the 10,348 direct Codex labels and calibrated to design-weighted sample rates; fields without enough sample support carry no Codex call. Candidate is the union of the two sides; consensus is their intersection. These outputs are machine_predicted_unvalidated and are not human labels.

metaresearch head score (Codex)0.000
metaresearch head score (Gemma)0.001
Version: metacan-v3-hybrid-931329e0061cValidation status: machine_predicted_unvalidated
Candidate categoriesnone
Consensus categoriesnone
DomainCandidate signal: none · Consensus signal: none
Study designCandidate signal: Not applicable · Consensus signal: none
GenreCandidate signal: Empirical · Consensus signal: Empirical
Teacher disagreement score0.061
Threshold uncertainty score0.121

Distilled classifier scores by category (both heads)

CategoryCodexGemma
Metaresearch0.0000.001
Meta-epidemiology (narrow)0.0010.000
Meta-epidemiology (broad)0.0000.000
Bibliometrics0.0010.001
Science and technology studies0.0010.001
Scholarly communication0.0010.001
Open science0.0010.001
Research integrity0.0010.001
Insufficient payload (model declined to judge)0.0060.003

Machine scores (provisional)

The two teacher heads of the student model, read on this work. A score orders the frame for review; it never asserts a category, and the validation status ships verbatim with every row.

Baseline scores from an immature model (maturity gate not passed, 7 training rounds). Scores rank; they never assert a category.

Opus teacher head0.039
GPT teacher head0.233
Teacher spread0.195 · how far apart the two teachers sit on this one work
Validation statusscore_only:v0-immature-baseline · verbatim from the scoring run: score_only means the number may rank works, and no category label ships from it

Classification

machine, unvalidated

Machine predicted; a candidate call from one source (direct Gemma or distilled Codex), not a consensus.

The models applied no category: nothing in the taxonomy fit this work.
Study designNot applicable
Domainnot available
GenreEmpirical

How this classification was reached, model by model and score by score, is at the end of the page under "How this classification was reached".

Quick stats

Citations0
Published2025
Admission routes1
Has abstractyes

Explore more

Same venueZenodo (CERN European Organization for Nuclear Research)Same topicDiptera species taxonomy and behaviorFrench-language works237,207